Saturday, December 28, 2019

Racism And The New South Essay - 1343 Words

People from Central America who migrate to U.S are most likely to experience racism because of this homogenization pyramid. Which tempts to be divided into different categories where people identify with in their phenotype features. It is found in the article of â€Å"Becoming ‘Hispanic’ in the ‘New South’: Central America immigrants’ racialization experiences in Atlanta, Ga USA† by Robert A. Yarbrough and â€Å"Allà ¡ en Guatemala† by Lucila D. Ek, Ph.D. they can relate to racism that will eventually end up nowhere just something very negative. Racism is a serious issue, problem that is found pacifically those who migrate to the United States because of their appearance so this causes discrimination, ignorance and mistreated. In addition, discrimination has been seen throughout the centuries which has become something we still deal with. As a matter of fact, immigrants get treated differently usually because of their skin color or the language they speak. â€Å"Affiliations along with physical characteristics, accents, and other linguistic traits that society has associated with certain racial/ethnic identities serve as constant reminders of how of how individuals are perceived and thus how they see themselves† (Yarbrough). This can harm mentally because of them experiencing some type of rejection. Most can feel ashamed of where they come from and will try fit in by letting go of their culture. What I mean is that they will change by trying to be more â€Å"American† only that they haveShow MoreRelatedThe Hard Times of Blacks in the South in the 1940s624 Words   |  3 PagesTimes Of Blacks In The South In The 1940’s Racism was a big issue in the south in the 1940’s. Racism was a major issue in the south back then because of all kind of reasons for example the KKK, and the laws that would make the blacks inferior to the whites in the southern society. The author Richard Wright wrote the book Black Boy about his own childhood. Richard Wright’s writing was influenced by his experiences with racism, Jim Crow laws, and segregation in the south in the early 1940’s. Read MoreMastering The Art Of Subtle Racism1732 Words   |  7 PagesMastering the Art of Subtle Racism Upon arriving in Chicago to lecture on financial inequality, Dr. Martin Luther King Jr. stated in the Chicago Tribune, I have never seen, even in Mississippi and Alabama, mobs as hateful as I ve seen here in Chicago...yes, it s definitely a closed society† (Chicago Tribune 1). The south has a notorious and profound history in regards to racism and civil rights. As racial relations grew and evolved, the south became notorious for lagging behind the progressiveRead MoreRacism : Racism And It Is Fair For Label A Country Racist?1648 Words   |  7 Pages In the recent years, racism has been at its highest, so the media reports to the public. Through sports, policing, and schooling, some story of racism is written up by a major news organization and society goes into disbelief. In any community, racist people exist, but with all the recent stories written by major and minor news organizations, it raises the underlined theme that America is racist. But, it is fair to label a country racist? In order to answer the question, there needs to be a setRead MoreThe South : America With A Difference1697 Words   |  7 PagesScholars have referred to the South as â€Å"America with a difference†. This difference has tried to be defined by different historians, and it has produced various strains of the American South history. Therefore, the south has drawn various historians, novelists, and poets in the quest to define the central theme of the southern history. This has largely interested many scholars as the south was known to be settled by a different Englishman, its experience of poverty since it was a nation that onlyRead MoreShruti Dhody. Professor Wiblin. Watsons Go To Birmingham852 Words   |  4 Pagesdevastating struggles of racism that affected the southern states of America, as well as the unity and comfort of a loving family. After an intense cold winter in Flint, Michigan, and the continuation of Byron’s (the oldest Watson son) behavioral issues, Mr. and Mrs. Watson decide to take a family trip to Birmingham, Alabama to leave Byron with Grandma sands (Mrs. Watson’s mother) for the summer. However, their plans quickly change as they experience sever acts of racism and hatred that take overRead MoreAfrican Apartheid And Its Historical And Theoretical Context1430 Words   |  6 Pagespractices from South-African apartheid alongside globalization. In this paper, we will consider the appropriateness of such term and whether it truly encompasses all aspects of global inequality. We will consider South-African apartheid along with its associated focus on race as well as globalization along with its associated focus on class and nationality. We will examine how these concepts encompass the statist, racialised, classist new world order. We commence by examining South-African apartheidRead MoreEssay On Racism In To Kill A Mockingbird952 Words   |  4 Pages The courthouse in the book To Kill a Mockingbird is represented as an old, traditional setting in the deep south, and with traditions of the deep south comes racism. In giving Scout a lesson in how racism works, Atticus also does the same for the readers. On the syllabus of this conversation: the power of language, not only as a way to shame those who don’t toe on the racist line, but also to set the terms of the debate. Racists use â€Å"nigger-lover† to suggest African Americans special rights.,Read MoreStripped of Civil Rights during Apartheid in South Africa830 Words   |  3 Pagesenforced in South Africa. With this policy, colored people (mixed or black) were deprived of housing, education, and work. The policies of apartheid were so strict that if a colored were to speak about a white person, they would be in danger of getting arrested. After all these years that the coloreds suffered through, Nelson Mandela fought hard and eventually got apartheid abolished. Many people believe that racism is gone from South Africa now while others say it is still there and New York TimesRead MoreSexism and Racism in â€Å"The Color Purple† Essays870 Words   |  4 Pages I feel every person should care about sexism and racism, because these two issues affect everyone. â€Å"The Color Purple† is a great film that focuses on the problems African American women faced during the early 1900s. The Color Purple provides a disturbing and realistic account into the life of Celie, a poor southern black woman with a sad and abusive past and Sophia, another poor southern black woman with a sad and abusive past. Sexism is a form of discrimination basedRead MoreThe Apartheid Of South Africa1440 Words   |  6 Pagesit, is one of the most impactful events on New Zealand, and even South African society. The controversial idea of having sporting interactions with apartheid ruled South Africa was not new to New Zealand politics, yet with Prime Minister Robert Muldoon in charge, the situation was escalated to astonishing heights. The violence all around New Zealand, between police, protesters and anti-protestors was immense. The impact that the 1981 â€Å"riots† had on New Zealand was not limited to the obvious sting

Friday, December 20, 2019

Merger An American Multinational Technology Company

Merger is the combining of two or more firms, generally by offering the stockholders of one company securities in the acquiring company in exchange for the surrender of their stock. Conglomerate is a kind of merger, a combination among two or more different companies, which focus on different business in the different market, as well as having no relationship in the productive process. Vertical Merger is the integration of the business which in the same industry but in the different step of supply chain. E-Commerce:conduct the business transaction electronically via Internet,including electronic trading market, Internet marketing, online transaction processing, electronic data interchange (EDI) etc. Alibaba Group Holding Limited is a†¦show more content†¦inject 1billion US dollar into Alibaba,becoming the biggest stockholder in Alibaba. Advantage The merger of those companies enable to optimizing the resources and achieve the resources complementarity,improving the efficiency of the economies of scale.Alibaba takes up the certain market share in China,and Yahoo haves a strong reserve funds , advanced high level of scientific research,which were exactly the values that the opposite side wants.The business of Alibaba and Yahoo quite different,but closely related.Both of them are Internet-related companies, but Alibaba focused on E-Commerce,while the core business of Yahoo is search engine.Actually,The core of Alibaba is business via Internet,so the most important part for operating is to acquire as possible as much information.Yahoo as the search engine, efficient station search allows users to quickly and accurately find the target information, so as to more effectively promote the sale of products/services.Obviously,with using the large database of Yahoo,Alibaba collect information channel is more accessible,for example the s ale enterprise merger can make the enterprise can more quickly understand the

Wednesday, December 11, 2019

Challenges of People with Spina Bifida and Spinal Cord Injuries

Question: Discuss about theChallenges of People with Spina Bifida and Spinal Cord Injuries. Answer: Introduction People with disability (PWD) face challenges as far as the job market and economy is concerned. Currently, they have a very limited prospects of getting employed compared to other people who are non-disabled (Derose, 2014). Most organizations employ disabled people just to satisfy the part of the law that requires them to do so due to the fear of being branded negatively. This study will help to highlight the challenges that people who suffer from spina bifida and brain or spinal cord injury face in the job market. Spina bifida is a permanent birth defect where the spinal cord juts out of the spine. It is a type of the neural tube defect in which a part of the neural tube does not develop fully hence leading to complications in the spinal cord as well as the spinal bones that are also known as the vertebrae. Spina bifida exposes the spinal cord and other nerves hence making them vulnerable to adverse damages and other possible infections. These infections are the main reason for medical problems that are associated with individuals that suffer this defect (FoN, 2017). There are several types of spina bifida that comprise of myelomeningocele, meningocele, and spina bifida occulta (CareersPortal, 2017). Myelomeningocele is where the infants spinal cord remains open although along the back vertebrae. The opening allows the spinal cord and its surrounding protective membrane to protrude and forms a sac on the infants back. Myelomeningocele is the most severe type of spina bifida. Meningocele is a type of spina bifida where the protective membrane of the spinal cord pushes out through the spine. The spinal cord develops normally hence a surgery can be used to eliminate the protruding membranes without affecting the nerves. Finally, spina bifida occulta is one of the most common and minor types compare to the above. It is where one or more vertebrae of the baby do not develop properly leaving a very small gap in the spine. This type of birth defect does not cause any problems hence most people may not even realize that they have it (CareersPortal, 2017) . Injuries to the central nervous system normally lead to brain injuries or injuries on the spinal cord. People who suffer from a traumatic brain injury can also sustain spinal cord injuries. In the United States, about 12,000 spinal cord injuries are reported each year (Burns OConnell, 2013). These injuries are categorized into four types namely; incomplete tetraplegia, complete tetraplegia, incomplete paraplegia and complete paraplegia. People with tetraplegia are considered to have suffered injuries to one of the existing eight cervical spinal cord segments. Those with paraplegia have wounds or injuries in the lumbar, sacral or thoracic regions of their spinal cord (Stone, 2015). Spinal cord injuries are as a result of a sudden traumatic blow on the spine that causes a fracture, dislocation, crushing or compression of one or more vertebrae on the back. It can also be caused by a wound that penetrates into the spinal cord. Other complications that cause spinal cord injury include swelling, inflammation, bleeding and fluid accumulation around the spinal cord (Burns et al, 2013). Findings People with spina bifida face a lot of challenges and limitations in their workplace. However, since each individual finds the urge to fend for themselves and their families, these individuals ought to be encouraged to follow their vision and dreams to become who they aspire to be. The best job duties for people who suffer from this birth defect include clerical positions, administrative office assistants, secretaries, and receptionists. These duties do not demand a lot of movements and an individual can execute his or her duties at the comfort of their seats (Best, 2012). According to Dufton (2017), people with spina bifida tend to forget easily compared to non-disabled individuals. This problem often contributes to poor performance in their fields hence leading to stress and even can contribute to job quitting. Fortunately, this problem can be easily avoided by the affected individuals since they can note down their instructions so as to work on them in a certain specific order. Employers can also assist these individuals by giving them instructions on a written format so as limit the instances of forgetfulness (Dufton, 2017). Additionally, people who have these defects often look down upon themselves due to adverse mistakes they make in their workplace. These mistakes may be as a result of fatigue, stress or any other mobility limitation (NHS, 2017). If this stress is unchecked, the affected individual may end up losing interest in their duty due to demoralization. To avoid this, employers should give some lighter duties to the disabled individuals as well as giving room for a certain free time specifically meant for rest. Moreover, allowing the people with disability time to visit a counselor once or twice a month helps to build their self-esteem hence giving them the ability to forgive themselves when they make mistakes instead of beating up their inner beings. Most people with spina bifida have mobility challenges on their lower limbs. Since the brain uses nerves that run through the spinal cord to control body muscles, any harm of these nerves causes major problems as far as muscle movements are concerned (WHO, 2013). Due to a defect in their spinal cord, individuals with spina bifida find it hard to move their legs or other parts of their abdomen. Therefore, they live with a certain degree of paralysis that demand ankle supports to enable them to move around. This can be achieved b use of crutches or wheelchairs in case of severe paralysis (CDC, 2017). At the workplace, people with spina bifida ought to be free space for movement and their workstations should be near to a washroom. This will help to minimize the time used for movements. Additionally, their work desks should be modified to conform to their wheelchairs since most them find it straining to use other desks and chairs similar to people without a disability. Organizations and employers also must restructure and rearrange the offices meant for people with spina bifida so as to address some of the mobility challenges that the face. For instance, people with this physical disability may not be able to stretch to pick equipment from higher shelves. Therefore, the shelves should be lowered and arranged in a manner that is easier for these people to pick items at ease. Designing shelves in a cylindrical manner that is adjacent to the desk is highly recommended since reaching items will be just as a result of torching their wheelchairs around instead of moving (SBH, 2017). People who suffer from spinal cord injury face almost similar challenges with those who suffer from spina bifida. Most people with spinal cord injury face a lot of psychological challenges in relation to their return to work after rehabilitation. Their major concerns range from being able to retain their job with the pressure that comes from it to be able to sustain themselves financially. These sorts of aspirations, existing needs and anxieties plunge these individuals to severe stress due to uncertainties. Most of them may be forced to change their social lifestyle at their workplace since they can socialize and have fun with other workmates as before (Noe, Bjerrum Angel, 2014). Moreover, most of the people who suffer from spinal cord injuries take time to accept that the cannot do things that they used to do before. Therefore, readjusting to their way life is a challenge (TBI, 2016). To address this socialization and low self-esteem problem, employers and organizations should seek consultancy and counseling services to enable their employee to cope with their duties easily. People with this disability ought to be taught how to perform their duties as far as they could irrespective of their disability. Additionally, they should be involved in the process of rearranging their workplace to improve their adaptability since the may be forced to stick to the use of wheelchairs due to the injury (Noe et al, 2014). Discussions of Solutions For many reasons, relationships and socialization with friends, colleagues and other people may be affected be affected by physical impairments and cognitive disabilities. People with spina bifida and spinal cord injuries depend on a mobility assistive technology like wheelchairs or crutches. This, therefore, restricts these disabled individuals from accessing other places due to restricted mobility compares to people without a disability. These challenges are directly linked to poor social integration that people with a disability suffer from (Chan Dicianno, 2012). There are other communication disorders that are as a result of low intelligence quotient (IQ), slow learning and ineffective brain executive function and memory. They affect how an individual communicates when articulating their conversation as well as the contents of their phrases. Therefore, these communication disorders mainly seen in people with spina bifida can lead to peer rejection hence risking psychological and social adjustment (Lee, 2017). With this in mind, it is evident that social integration is reduced in people with spina bifida and those who suffer from spinal cord injuries as compared their able-bodied bodied colleagues. To address this challenge, employers ought to identify the job duties that do not demand man interactions. This will help protect the disabled individuals from discouragements that can lower their self-esteem (Chan Dicianno, 2012). Additionally, these individuals may be encouraged and also provided with an immersive technology that offers virtual socialization opportunities that are targeted at improving the quality of life of people and improve social integration of disabled people. The use of text and voice chatting programs will allow the users to interact with their peers in real time. This will help to eliminate certain delays and pauses in the speeches of people with spina bifida. Main barriers of employment in people with spinal cord injuries are more of environmental rather than biomedical, demographic or psychological. In their report, WHO (2013) ranks inaccessibility to workplace and discrimination as the most negative factors that people with spinal cord injuries face (Chan et al, 2012). They point out that these people have a functioning inability to execute their duties due to lack of endurance or lack of stamina. Therefore, the best way to address this is to modify the place of work to enable them to perform their preferred job successfully (WHO, 2013). Moreover, people with disability are normally prevented from working due to their inability to access effective transportation to and from work. This problem is experienced worldwide especially in the rural areas (OMahony, 2017). Recommendations An improvement of the health sector response is a prerequisite as far as the livelihood of people with spina bifida and those with spinal cord injuries are concerned. The health sector should be equipped in a manner that it will be able to strengthen prevention and early responses to spina bifida and spinal cord injuries respectively. They should also be able to provide effective rehabilitation services so as to improve the livelihood of the disabled in their workplace and homes. Assistive technology should also be made available in time and also be redesigned to help the patients execute their duties easier. Additionally, people with spina bifida and spinal cord injuries should be empowered so that they can take responsibility for their own health. This will help a great deal in enabling them to be independent. By doing this, their self-esteem will be improved dramatically hence improving their socialization. Finally, organizations and employers must give these people flexible working hours that will enable them to relax if need be. Social protection schemes also must be made available to these individuals especially on their economic status and their return to work formula. Conclusion In conclusion, incidences of traumatic spinal cord injuries and cases spina bifida in newborns should be reduced at all costs. However, this aspiration and need may not be effective as thought, therefore, the effects of these disabilities should be addressed professionally so as not to impact negatively on the lives of these individuals. Improved health care services, socialization management, rehabilitation and protection against discrimination will help steer the disabled individuals to achieve whatever they aspire. Accessible environments, care, and other supportive services should be provided to these individuals with the aim of minimizing disruptions in their way of life. Governments also should join hands with other stakeholders to guarantee social inclusion and good health to the disabled. References Best, A. (2012). Individuals with Spina Bifida Need Adequate Home Care Support. Retrieved October 6, 2017, from https://besthomecaremn.com/blog/adolescent-home-care/individuals-with-spina-bifida-need-adequate-home-care-support. Burns, A. S. OConnell, C. (2013). The challenge of spinal cord injury care in the developing world. The Journal of Spinal Cord Medicine, 35. Retrieved October 6, 2017, from https://dx.doi.org/10.1179/2045772311Y.0000000043. CareersPortal. (2017). Spina Bifida Hydrocephalus. Retrieved October 6, 2017, from https://careersportal.ie/disability/az.php?CAO_Courses__%3Ca_href=ed_sub_cat_id=92parent=20. Center for Decease Control and Prevention (CDC). (2017). Living With Spina Bifida: Young Adults. CDC. Retrieved October 6, 2017, from https://www.cdc.gov/ncbddd/spinabifida/adult.html. Chan, W. M. Dicianno, B. E (2012). Virtual Socialization in Adults With Spina Bifida. American Academy of Physical Medicine and Rehabilitation, 3, 219-223. Retrieved October 6, 2017, from DOI: 10.1016/j.pmrj.2010.12.002. Derose, R. (2014). People with disabilities still find job market a challenge. The Hill. Retrieved October 6, 2017, from https://thehill.com/blogs/congress-blog/labor/212986-people-with-disabilities-still-find-job-market-a-challenge. Dufton, M. (2017). Challenges in the Workplace. Retrieved October 6, 2017, from https://www.sbhao.on.ca/stories/personal-stories/challenges-workplace-mary-dufton. Focus on Disability (FoN). (2017). Spina Bifida - A Guide. Retrieved October 6, 2017, from https://www.focusondisability.org.uk/spina-bifida-information.html. Lee, D. (2017). Tight job market is good for felons, people with disabilities and others who are hard to employ. But can it last? Los Angeles Times. Retrieved October 6, 2017, from https://www.latimes.com/business/la-fi-hardcore-jobless-20170626-story.html. NHS Choices (NHS). (2017). Spina bifida. Retrieved October 6, 2017, from https://www.nhs.uk/conditions/Spina-bifida/Pages/Introduction.aspx. Noe, B. B., Bjerrum, M. Angel, S. (2014). Expectations, Worries and Wishes: The Challenges of Returning to Home after Initial Hospital Rehabilitation for Traumatic Spinal Cord Injury. International Journal of Physical Medicine Rehabilitation, 2:225. Retrieved October 6, 2017, from doi: 10.4172/2329-9096.1000225. OMahony, M. (2017). Disabilities in the workplace: are we failing our disabled workforce? The Guardian. Retrieved October 6, 2017, from https://jobs.theguardian.com/article/disabilities-in-the-workplace-are-we-failing-our-disabled-workforce-/. SBH Queensland Inc (SBH). (2017). About Spina Bifida and Hydrocephalus. Retrieved October 6, 2017, from https://www.spinabifida.org/spina-bifida-and-hydrocephalus/. Stone, J. H. (2015). Spinal cord injuries in the developing world. Center for International Rehabilitation Research Information Exchange (CIRRIE). Retrieved October 6, 2017, from https://sphhp.buffalo.edu/rehabilitation-science/research-and-facilities/funded-research-archive/center-for-international-rehab-research-info-exchange.html. TBI Philadelphia. (2016). Spinal Cord Injury. Retrieved October 6, 2017, from https://www.traumaticbraininjury.com/understanding-tbi/spinal-cord-injury/. World Health Organization (WHO). (2013). International Perspectives on Spinal Cord Injury. WHO Library. Retrieved October 6, 2017, from https://apps.who.int/iris/bitstream/10665/94190/1/9789241564663_eng.pdf.

Wednesday, December 4, 2019

Competency Integration in Accounting Education †MyAssignmenthelp

Question: Discuss about the Competency Integration in Accounting Education. Answer: Introductions: Communication is regarded as the core activity in the profession of accounting as communications facilitates transformation of interest from one person to another person or a combination of both and to shareholders or stakeholders of the organizations. Effective communications form the important aspects of the business dealings with employees and outsiders such as vendors and clients (Wilson, Gray and Hamilton 2016). Accounting forms an inherent part of any business and goods communications is considered as the vital in performance of business activities. Significant financial tasks in the form of preparation of budget and reporting, payment of bill, payroll and recording of income should be presented appropriately to the management and others to be regarded as useful and meaningful. The function of communication is to make sure that each member of the organization knows what is anticipated. Good communications is considered to be critical in ensuring coordination and control of each individuals, group and departments (Wilson, Gray and Hamilton 2016). The profession of accountancy must understand clear and succinct communications along with the significances of poor communications. Better communications make sure that individuals understand what they anticipate, that the correct person obtains the correct information and ensure appropriate coordination inside the organizations. It makes sure that the control of the organization plans and procedures and the instructions provided by the management to the staff are understood. In the modern world accountants are faced with the complex situations. They are not only burdened with the responsibility of measuring economic data but they also have to shoulder the responsibility of communicating the data in a meaningful manner to the various users or receivers of the accounting information (Gaviria, Arango and Valencia 2015). These users are generally investors, creditors, government, management and others within the business organization. All these users need accounting information since this information are important in decision-making processes. The most noteworthy use of the accounting facts is to communicate significant evidence that allows the organisation to undertake good decisions (Wilson 2016). In order to make the information real, accounting information should be meaningful and must be understood otherwise it is simply the list of facts having no actual meaning. Several business makes the use of the templates for interior reports in order to communicate information in a matter, which is conversant and simple to use by the organisation. For instance, financial departments might obtain actual versus budgeted forecast reports each month as using this similar format might help in understanding and analysis. Other vital users of the accounting information are the investors as they are the one that wants to know and understand the how the business is performing financially. Generally, such kind of accounting information is communicated with the help of the standard reports generally in the balance sheets and income statements, accumulated by using generally accepted accounting principles (Apostolou et al. 2015). A balance sheet represents the assets, including cash, liabilities and owners equity. An income statement on the other hand represents income and expenditure of the business during a specified period of time. Both such statement are combined each month that allows the comparison and analysis from the investors point of view. A large number of investors would want to see whether cash flow statements having information regarding inflow and outflow of the money. An important consideration regarding the communication of accounting information is that such information should be communicated correctly to the government units at the time of levies (Lawson et al. 2015). For instance, taxes require sales and makes the use of tax on specific substances with accounting evidence should be obtainable under an assured manner to be significant. Alternative example of government communications is the yearly tax return with interior revenue service as under such circumstances evidence is following the specific rules and regulations. Banks on the other hand, might want to be appraised regarding the monetary situation of the companies, by establishing communication of accounting substances forming as the main concern in several companies. In the case of the bank loans, there can be episodic reports that makes the use of the accounting information (Rebele and Pierre 2015). Banks are generally involved in the cash flows and might need distinctive reporting in case of a companys position of liquidity together with both the short-term books receivables and payables. All this kind of material should be conversed to the bank clearly or else the business might not obtain loan. One of the best example of promoting effective communication for any form of accounting information is to do the same in writing and in a report format in accordance with the description on the left hand side of the pages. This helps in effective transformation of accounting commination with summarized version of information to facilitate better understanding for the financial users of the information. The significance of communication in accounting is considered as the language of the business, there are large number of people that consider accounting as the number however accounting is more than just the number (Dickfos, Cameron and Hodgson 2014). Business is changing and so are the belief regarding the descriptions along with the associated skills necessary to perform the jobs. An important consideration in this regard has been bought forward which states the stereotypical role of the accountant is merely characterised as the introverted persons. As numbers should be replaced with the understanding that current, accounting professionals is necessary to possess the interpersonal skills to help with the decision-making procedure across all the areas of functions regarding the accounting principles and decisions. The accountant of current era, particularly under the realms of the managerial accounting are required to communicate their ideas and financial information to others in the company of many where non-accountants and non-financial people are tactful and effective. Management accountant are required to be now a better communicator (Deegan 2013). The Practical analysis of the management accountant sought after in determining the methods involved in the changing roles of the accountants. There are circumstances when the accountants and the management will be able to communicate better regarding the changes and results and the information relating to the financial statements. Additionally, effective communication helps in providing accurate information in the form of various notes. In order to administer such situations, the accountant and the manager are required to develop the effective communication skills both verbally and in written manner (Lawson et al. 2016). this will additionally help in enabling communication amid the international users of the financial instrument along with the companies that seek to publish the information. Several studies have examined that oral communications skills is considered as the usually graded working accountants being the further significant than the written skills of communications. According to several studies that have distinguished amid the formal and informal communications skills. As stated by Jack, Davison and Craig (2013), there has been an evidence where the accountants as more significant than the formal skills of oral communications regard oral communications skills. Similarly, informal writing skills is placed on the higher side in the list of important practicing accountants than the formal writing skills. According to Wilson (2016), professionals of accounting must be able to present, converse and report their opinions with the help written and spoken communications. Although the readings have unswervingly addressed the communications skills required by the working accountants however, the general conclusions are regarded as uncertain. There is certain agreement that states that the practicing accountants regard informal oral and written skills of communications as the most noteworthy. Several research has revealed some of the contrasting views among the instructors and secretarial practitioners regarding how the communications skills must be prioritized. As stated by Slack (2014), it has been reported based on the survey that the opinions of the commercial communications instructors and bookkeeping practitioners are carefully associated. However, the opinions of the practitioners have deviated from what was stated in the survey. The deviation states a greater requirement for cooperation among the accounting professionals and the specialist of communications so that an improvement can be made level of communications for the graduates accountants. The significance of communication skills regarding accountants have been measured and conversed for more than half a century. Nevertheless, several elementary queries continue to be unanswered or remains unsettled. One of the prime reason surrounding the queries is the weakness in the classifications of communications skills considered in the previous studies. In addition to this, a large number of the current skills of communication researched is out-dated with slender in possibility and is restricted to terrestrial research. One of the important challenge for the secretarial instructors is to make sure that the transferable is aligning with the most regularly achieved task of communication in bookkeeping. To attain this, there must be a collaboration among the instructors, practitioners and in specific communication specialist to recognize the pertinent skills of communications that is required to be implemented in the accounting programs. As stated by Ahadiat and Martin (2016) educators that are involved in the incorporation of the communication skills in the accounting agendas must ascertain the lessons in providing necessary, movable abilities for the practicing professionals. Greater degree of teamwork among the secretarial profession, accounting instructors and communication specialist is considered to be critical, assuming the viewpoint that has been detected amongst the three groups. As cited by Wilson (2016), detailed technical proficiency would always form the part of the accounting success however accountants that develops the skills of strong communications will have greater chances of success. As understood, practicing accountants seem to consider the significance of the informal communication skills greater than the formal skills of communication. Burns and Needles (2014), have placed greater amount of importance for accountants having the aptitude to communicate the nonconcrete ideas to the audience with non-accountants backgrounds in the casual settings. Instructors on the other hand, have placed formal communication skills over the informal skills of communications. This suggest a disconnection and suggests that programs of accounting may not be placing emphasis or arranging the abilities of communications that is considered very critical to the occupation. As such, the difference amid the formal and informal communication skills should be evidently recognised and agreed. Facts on the comparative implication of formal versus the informal communications skills across both the oral and written dimensions and underlying the attributes along with the components, which supp orts these, must be defined with the help of carefully designed research studies. Conclusion: On arriving at the conclusion, the study has reviewed the current literature and has identified the numerous skills concerning the knowledge gaps. It lay down the substance for forthcoming investigators that are interested in discovering the abilities of the communications by the accountants. By more specifically recognising the wants and anticipations of practicing accountants, educators of accounting will be better capable of targeting particular communication skills and components through which the design of the accounting program and innovation educations. The study has conclusively placed greater amount on the formal communication with greater amount of emphasis must be placed on the informal communication. Reference List: Ahadiat, N. and Martin, R.M., 2016. Necessary attributes, preparations, and skills for the selection and promotion of accounting professionals.Journal of Accounting and Finance,16(1), p.11. Apostolou, B., Dorminey, J.W., Hassell, J.M. and Rebele, J.E., 2015. Accounting education literature review (20132014).Journal of Accounting Education,33(2), pp.69-127. Burns, J.O. and Needles, B.E. eds., 2014.Accounting Education for the 21st Century: The global challenges. Elsevier. Deegan, C., 2013.Financial accounting theory. McGraw-Hill Education Australia. Dickfos, J., Cameron, C. and Hodgson, C., 2014. Blended learning: making an impact on assessment and self-reflection in accounting education.Education+ Training,56(2/3), pp.190-207. Gaviria, D., Arango, J. and Valencia, A., 2015. Reflections about the use of information and communication technologies in accounting education.Procedia-Social and Behavioral Sciences,176, pp.992-997. Jack, L., Davison, J. and Craig, R. eds., 2013.The Routledge companion to accounting communication. Routledge. Lawson, R.A., Blocher, E.J., Brewer, P.C., Morris, J.T., Stocks, K.D., Sorensen, J.E., Stout, D.E. and Wouters, M.J., 2015. Thoughts on competency integration in accounting education.Issues in Accounting Education,30(3), pp.149-171. Lawson, R.A., Pincus, K.S., Sorensen, J., Stocks, K. and Stout, D.E., 2016. Managing the Curricular-Change Process: Implementing Competency-Based Accounting Education. Rebele, J.E. and Pierre, E.K.S., 2015. Stagnation in accounting education research.Journal of Accounting Education,33(2), pp.128-137. Slack, R., 2014. The Routledge companion to accounting communication. Wilson, R.M. ed., 2016.Researching Accounting Education: Australian Contributions. Routledge. Wilson, R.M. ed., 2016.Researching Accounting Education: Australian Contributions. Routledge. Wilson, R.M., Gray, F.E. and Hamilton, L. eds., 2016.Communication in Accounting Education. Routledge.

Thursday, November 28, 2019

Gold In Grendel Essays - Beowulf, Grendel, Parallel Literature

Gold In Grendel Gold has many different uses. In John Gardner's novel Grendel, it is used as a motif to symbolize different aspects of a character. Though it has a constant meaning throughout the novel, it also differs according to each character. Gardner uses gold as a symbol of majesty as well as protection, greed and power throughout the novel especially related to the characters of the Shaper, Hrothgar and the Dragon respectively. To the Shaper, gold symbolizes majesty as well as protection. He was ?beyond the need of any shaggy old gold-friend's pay (49).? The Shaper did not merely work to earn his gold; he sang his songs of old because they were his passion and his love. The king supported him, and that was all he needed. He had no desire to obtain the gold, and in turn, he gained more. The gold was also his protector. At the time of his death, the women covered his eyes with gold to keep him from seeing where he went (145). It protected him from seeing the corruption and greed in society. Because of this protection, he was able to keep his focus on the inspiration of his songs. Then there is Hrothgar, to whom gold symbolizes majesty as well as greed. During the wars between the various kings, they threaten to steal each other's gold and burn the meadhalls (33). The gold became a symbol to the people of who was the stateliest ruler between the Danes. The gold became their supremacy. To Hrothgar, as well as the other kings, their gold symbolizes their greed for the other's kingdom and the other's wealth. Hrothgar coveted the gold of other kings and made it his quest to control what he wanted. Even his own sons did not care about their father. They merely weighed his worth by how much gold he possessed (53). Their greed for power outweighed their desire for justice in ruling. They only wanted money. To the Dragon, gold symbolizes majesty and power over humans. Gardner first describes the Dragon as ?vast and red-golden? with tusks that shimmered as if they were made of gold(57). The dragon is very prestigious. He has the demeanor of a ruler. He understands and he knows the future and sees that as a form of power and control over everything. He persuades Grendel to attack the humans because he knows that he will do it anyway(69). The dragon also knows that he will also perish, so he wants to gather all the gold that he can to display his power while he still lives. For, unlike Grendel, he ?covets gold, not souls (1).? Gold can mean different things to different individuals. To some, like the Shaper, it can cover their eyes from corruption. Yet, for others, like the Dragon and Hrothgar, it can become the source of their corruption. Everything depends on what their desire is. English Essays

Sunday, November 24, 2019

Capital City of Canada Why Ottawa

Capital City of Canada Why Ottawa SAT / ACT Prep Online Guides and Tips Whether you’re preparing for a geography exam or simply want to learn more about your friendly neighbor to the north, we’ve got you covered. In this guide, we'll answer an important question everyone should know the answer to: what is the capital of Canada?In addition, we'll explain how this place came to be the capital city of Canada and what all the capital cities of the Canadian provinces and territories are currently. What Is the Capital of Canada? The capital of Canada is Ottawa, which is located in Ontario- that is,the province directly above the Great Lakes and the US states of Minnesota, Wisconsin, Michigan, Ohio, and (part of) New York. Ottawalies on the south bank of the Ottawa River, which runs between and defines the borders of the provinces Ontario and Quebec. Opus Penguin/Flickr Together, Ottawa and the city of Gatineau, which is located directly across from Ottawa in Quebec, make up the National Capital Region called Ottawa-Gatineau. This specially designated region refers to not only the cities themselves but also their surrounding Census Metropolitan Areas. Due to Ottawa’s placement between the primarily English-speaking Ontario and the mostly French-speaking Quebec, it is one of the most bilingual cities in Canada. Beloware some quick facts to know about Ottawa, the capital city of Canada: Location: Southeastern Ontario Original Settlers: Odawa tribe ("Odawa" is said to mean "traders") in the mid-17th century Population (2016): 989,567 (Ottawa-Gatineau) Population Rank (2016): Sixth-largest city in Canada (Ottawa-Gatineau) Year Established: 1850 as town of Bytown, 1855 as city of Ottawa Climate: Continental, with warm summers (70℉) and cold winters (15℉) Major Employer: Federal government Landmarks: Parliament Hall, ByWard Market, National Gallery of Canada, Rideau Canal, University of Ottawa Closest US State: New York Closest Big City: Montreal in Quebec A Brief History of the Capital of Canada Ottawa has been the capital city of Canada ever since Canada became a self-governing country. But how exactly did it manage to become the capital of Canada- and why? In 1841, what was originally called the Province of Canada (the present-day provinces of Ontario and Quebec) came under British colonial control. The next 16 years witnessed ongoing disputes over what the capital of the new province should be; contenders included Quebec City, Toronto, Montreal, Kingston, and finally Ottawa. Each of these cities held the title of capital of Canada for varying lengths of time. Here is a chronology of exactly how the capital city of Canada changed in just two and a half decades: Kingston (1841-1844) Montreal (1844-1849) Toronto (1849-1851) Quebec City (1851-1855) Toronto (1855-1859) Quebec City (1859-1865) Ottawa (1866-present) It was clear already by 1857 that the decision of where to place the capital of Canada was going to be difficult and time-consuming. At this time, Queen Victoria was asked to select the capital city of Canada. Her choice of Ottawa- a fairly small and newly incorporated city- surprised many. Still, Ottawa had a lot of promise: it was starting to experience economic growth and was home to an impressive railway system; it also had a long history of trade due to its location near several rivers. Butnot everyone agreed with the queen’s pick,which led Toronto to remain the capital for another two years followed by Quebec City for another six years. It wasn’t until 1866 that Ottawa was officially designated the capital city of the Province of Canada and began to hold Parliament. In 1867, the Province of Canada became the Dominion of Canada, making it an official, self-governing colony of the British empire. This also meant that Ottawa was the first (and so far only) official capital of Canada as we know it. What Are the Capital Cities of Canada? We now know that Ottawa is the capital city of Canada, but what about the capital cities of all the provinces and territories within Canada? Similar to the United States, where there is a capital city for each state, Canada has capital cities for all 13 of its provinces and territories. The following chartdepicts the capital city of each Canadian province/territory and its population from the 2016 census. Provinces and territories are listed alphabetically. Province/Territory Capital City Capital City Population (2016) Provinces - - Alberta Edmonton 932,546 British Columbia Victoria 85,792 Manitoba Winnipeg 705,244 New Brunswick Fredericton 58,220 Newfoundland and Labrador St. John’s 108,860 Nova Scotia Halifax 403,131 Ontario Toronto 2,731,571 Prince Edward Island Charlottetown 36,094 Quebec Quebec City 531,902 Saskatchewan Regina 215,106 Territories - - Northwest Territories Yellowknife 19,569 Nunavut Iqaluit 7,740 Yukon Whitehorse 25,085 Note that while the capital city of Canada (Ottawa) is located in Ontario, it is notthe capital of Ontario itself- thisstatus belongs to Toronto. For most provinces/territories in Canada, the capital city is also the most populated city, but this isn’t always the case. Here are the biggest cities for the Canadian provinces for which the capital city is not the most highly populated: Province Biggest City City Population (2016) Alberta Calgary 1,239,220 British Columbia Vancouver 631,486 New Brunswick Saint John 67,575 Quebec Montreal 1,704,694 Saskatchewan Saskatoon 246,376 What’s Next? Are you taking the IB geography class? Then you might want some tips and resources with our comprehensive guide. Preparing for the AP Human Geography exam?Get an overview of what's on the test and then learn the best ways to study for it. You can also check out our expert picks for the best AP Human Geography prep books.

Thursday, November 21, 2019

Observing K-3 Science Activities & Observing K-3 Math Activities Coursework

Observing K-3 Science Activities & Observing K-3 Math Activities - Coursework Example For instance, increasing their proficiency would mean sitting down them individually or in small groups and explaining the concepts to them through real-life methodology. Collaborating is undoubtedly essential in order to thrive in any profession as the thoughts of ideas, knowledge, and practices are exchanged. Quite often, students struggle to socialize in a pre-dominant learning environment as I witnessed this first hand. Whiteboards, technical stimulation were used. In addition, an application was used to teach children in a better manner so their minds can be stimulated. This was crucial to their learning development because the kids interacted with it. g. What types of questions were used during the lesson? What research-based strategies are being used to promote critical and higher order thinking? Content area vocabulary? Do the techniques and strategies used promote diversity, openness, inquiry, and support? Many open-ended questions were utilized to answer these questions. First and foremost, kids were given problems that they needed to solve in a highly skilled manner. Additionally, students were propagated to promote critical thinking by thinking outside the box. I like the fact that they can use other techniques instead of boring drills. Yes, I think they do promote openness and the desire to learn. The purpose of education is to ensure that students become good moral citizens of society and make sound decisions that can facilitate humanity. It is clear to point out those morals such honesty, integrity, and morals are derived from important nurture. Another purpose of education is to collaborate and engage in peer tutoring. Peer tutoring is an essential learning tool because it facilitates the process of collaboration and writing a social artifact. Peer tutoring is an extremely innovate idea since it combines collaborative and cognitive learning as students learned from tutors and tutors

Wednesday, November 20, 2019

A managerial approach to marketing Essay Example | Topics and Well Written Essays - 2250 words

A managerial approach to marketing - Essay Example Competitive pressures to deliver specific products to meet consumer demand have changed the way the products move from the producer to the consumer. Any company has to adopt new marketing strategies in order for it to survive in the ever competing environment. The marketing landscape has shifted in that technological innovation, new channels, regulatory compliance, bottom-line accountability and rising customer expectations are altering the playing field. Marketing managers are unraveling these complexities in order to spearhead initiatives that capitalize on the customer-driven market place. It is important to place the customer at the core of strategic decision making hence marketing managers can better align marketing resources, spend, mix and technology investments. Strategy and technology can then coalesce to profitably meet customers’ needs, which enhance brand performance, increase customer value and position the enterprise for growth capability of outpacing competitors. This strategic brief addresses central issues on the minds of today’s marketing managers. As technology advances and consumers gain clout, traditional batch and blast marketing approaches designed to maximize new customer acquisition without regard for customer needs and long-term value will under perform. Launching marketing programs around new products for short-term revenue wins will not be enough to sustain returns and surpass competitors. Technological innovations are constantly altering the playing field. Analytic solutions are bringing new levels of customer intelligence, allowing marketers to understand individual customer needs. Optimization tools have increased marketing velocity and shortened cycle times. Consolidated, clean customer data stores can be matched with event-based campaign management tools to improve message accuracy, timeliness and relevancy. As technologies come to

Sunday, November 17, 2019

The Greeks and Philosophy Research Paper Example | Topics and Well Written Essays - 1500 words

The Greeks and Philosophy - Research Paper Example For, â€Å"†¦without any assistance of sense, and perseveres until by pure intelligence he arrives at the perception of the absolute good, he at last finds himself at the end of   the intellectual world, as in the case of sight at the end of the visible.†2 Philosophy is about finding points that will lead one to theorize. Philosophy includes â€Å"†¦steps and points of departure into a world which is above hypotheses, in order that she may soar beyond them to the first principle of the whole†¦Ã¢â‚¬ 3 â€Å"Until the person is able to abstract and define rationally the idea of good, and unless he can run the gauntlet of all objections, and is ready to disprove them, not by appeals to opinion, but to absolute truth, never faltering at any step of the argument --unless he can do all this, you would say that he knows neither the idea of good nor any other good; he apprehends only a shadow, if anything at all, which is given by opinion and not by science; --drea ming and slumbering in this life, before he is well awake here, he arrives at the world below, and has his final quietus.†4 For Plato, what equaled philosophy included the truth. â€Å"And I thought that I had better have recourse to ideas, and seek in them the truth of existence.†5 Naturally, the most logical thoughts that were reinforced as correct were what Plato considered philosophy, saying that â€Å"†¦I first assumed some principle which I judged to be the strongest, and then I affirmed as true whatever seemed to agree with this, whether relating to the cause or to anything else; and that which disagreed I regarded as untrue.†6 True philosophy, after all, lies â€Å"†¦in [the] asking and answering questions†¦Ã¢â‚¬ 7 Rejecting the false and embracing the truth seems to have been what Plato was searching for all the time in his dialogues. The process of philosophy was about digging into the psyche to find a deeper truth. The process involves lots of rational thinking, evaluation, and critical thinking skills. Not only that, but Plato’s ideas of philosophy held fast to the ideas that what was good and virtuous were things that were worth philosophizing about. This process of parsing out what was good and virtuous in itself was worth it to Plato to take great pains to try to explain—in detail—what was worth expounding upon in his dialogues. Plato consistently maintained that philosophy was a constant search for that which was real, good, true, and reliable—versus that which was fake or a facade, bad, untrue, or inconsistent. Constistency is what made Plato such an emblematic figure in philosophy, because one knew what to expect from his type of logic. Therefore, his points were not only true but rational. B) Find at least two passages in the dialogues that were covered in this module where Plato shows Socrates entering into the dialectical process of Philosophy. Copy and paste the passages usi ng quotation marks and cite the source dialogue. You find two passages where Socrates is exchanging questions and answers with someone on a topic, issue or question. Where do you find these passages? Find them in any of these dialogues: ION EUTHYPHRO APOLOGY CRITO PHAEDO REPUBLIC SYMPOSIUM ?DO NOT USE THE SEVEN PASSAGES SUPPLIES IN PART A THAT DESCRIBE DIALECTICS! Those passages are not demonstrations of the process but are descriptions of it. How long do they need to be? Not the entire dialogue! Just submit a passage long enough to see the back

Friday, November 15, 2019

Comparison of Techniques for Diagnosis of Multiple Sclerosis

Comparison of Techniques for Diagnosis of Multiple Sclerosis Background: There is increased need to develop specific biomarkers for multiple sclerosis (MS) to aid in the diagnosis, improve the management of patients and the monitoring of the effectiveness of treatment. Oligoadenylate synthetase 1 (OAS1) is up regulated by type 1 interferon. A single nucleotide polymorphism (SNP) in exon 7 of OAS1 results in differential enzyme activity. Objective: To correlate different OAS1 genotypes, in patients with relapsing remitting multiple scleroses (RRMS) under interferon-beta (IFN ÃŽ ²) therapy, with disease activity. Subjects and Methods: OAS1 genotype was assessed in 20 patients with RRMS and 20 age and gender matched healthy controls. All patients were medicated with IFN ÃŽ ². The patients were subdivided in terms of disease activity assessed by Expanded Disability Status Scale (EDSS), in two groups; group I with minimal disease activity and group II with severely active disease. All patients were followed up every 6 months for a period of 2 years . Results: Genotyping analysis of the OAS1 gene revealed a significant difference between RRMS patients and control group, with lower frequency of GG in patients (25%) compared to controls (65 %) (p = 0.0001). Furthermore, AA genotype was detected 35% of patients compared to 0% in controls (p = 0.01). Regarding disease activity, AA genotype had a significantly higher frequency (71.4%) in patients with severely active disease compared to 15.4% in patients with minimally active disease (p=0.0001). Conclusions: The A-allele is considered risky and the G is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity. Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system, the etiology and pathogenesis of which remain largely elusive. The most common form of MS is the relapsing–remitting form (RRMS), in which episodes of acute worsening of neurological function (relapses) are followed by partial or complete recovery periods (remissions) free of disease progression.1,2 Type 1 interferons (IFNs) are innate immune cytokins that activate the JAK/Stat signaling pathway leading to induction of IFN-stimulated genes. The 2,5-OAS family is central to the IFN antiviral pathway for viruses whose replication includes production of double-stranded RNA. One member of this family of proteins, OAS1, induces RNAseL, resulting in degradation of viral RNA, inhibition of virus replication, and promotion of cellular apoptosis.1 Several OAS1 polymorphisms have been reported; one located at the exon 7 splice-acceptor site results in alternative splicing of the OAS1 mRNA. Although clinical trials have proven the efficacy of interferon-beta (IFN ÃŽ ²) in the treatment of RRMS2-4, over one-third of patients have continuing significant disease activity.5 On purely clinical grounds, patients have variously been considered to have responded poorly, based on relapse occurrence6-9 or on disability progression while receiving IFN ÃŽ ² therapy.10 Therefore, cohorts of patients receiving IFN ÃŽ ² can be informative for evaluating general determinants of disease activity. Aim of work: to examine the relationship between OAS1 genotype and indices of disease activity in RRMS under IFN ÃŽ ² therapy. Subjects and Methods Twenty patients with RRMS according to revised McDonald criteria11 were enrolled from an outpatient and inpatient population attending Neurology Department, Tanta University Hospital. Twenty unrelated age- and gender-matched volunteers, with no history of MS or other neurologic disease, were recruited as a control group. All patients received IFNÃŽ ² therapy and followed up every 6 months over a period of 2 years from January 2010 to January 2012. The Ethics Committee of Hospital approved the study, and a written informed consent was obtained from each participant. For all patients, baseline data collected included disease duration, age at onset, relapse history prior to therapy, and clinical disability measured using the Expanded Disability Status Scale (EDSS).12 Relapses were defined as an episode of neurologic disturbance lasting for at least 24 hours and not caused by a change in core body temperature or infection.13 Disability progression was defined as an increase in EDSS score by 1 point from baseline confirmed at 6 months.5 Genomic DNA was isolated from peripheral blood samples. Primers were designed to specifically amplify a 347-bp product surrounding the rs10774671 SNP. A total of 5 grams of genomic DNA was amplified by PCR. Primer sequences used were; rs 10774671 – forward, TCCAGATGGCATGTCACAGT and reverse, AGAAGGCCAGGAGTCAGGA. Amplification conditions included initial denaturation at 94 centigrade for 2 minutes, followed by 28 cycles at 94 centigrade for 20 seconds, 62 centigrade for 40 seconds 72 centigrade for 30 seconds, with a final extension for 7 minutes at 72 centigrade. The PCR products were digested with the ALU1 restriction enzyme. Digested products were analyzed by agrose gel electrophoresis and genotypes were assigned, the A-allele coding for a truncated form with low activity and the G conferring high enzymatic activity. Patients were assigned to 1 of 2 groups. Group I included minimal disease activity; patients who experienced a maximum of 1 relapse after 24 months of IFNÃŽ ² therapy and had no sustained disability progression. Group II included a severely active disease; patients who had 2 or more relapses on IFNÃŽ ² therapy over 24 months with or without sustained disability progression.14 Statistical Analysis SPSS 10 was used for data analysis.15 P value

Tuesday, November 12, 2019

media Essay -- essays research papers

Media Manipulation There is a very subtle, yet powerful force at work on our world today. It is trying to control what woman and young girls do say and believe, especially about their own appearances. The media portrays unrealistic images that affect the way people, particularly woman, feel about themselves. And there is no way to avoid it. The media acts as a transmitter of potentially dangerous, socially desirable values and norms. Anyone can become a victim without even realizing it. Woman are told to believe distortions, inaccuracies, and bias on a daily basis. Somehow in that all the madness thinness has become synonymous with attractiveness. It is the media's job to surround us with slogans and pictures that are able to etch themselves into brains. (Stevens 44) Television, movies, magazine ads, commercials and billboards all attribute to the growing influence the media has on women. (www.rethinkingschools.org). Young girls are the most influenced by the media and its manipulation.(www.ed.gov .ERIC...). However, society as well as the media, has put forth dangerous and concentrated images, that have a strong impact on the lives of woman of all ages. Society has always placed a great emphasis upon the importance of a woman's appearance, and through that emphasis woman have been taught to measure their self worth in terms of the image they present, even more so than their own intelligence. They have been given rigid and challenging standards to live up to, standards that are usually unrealistic, unattainable, and disheartening. Many woman spend the majority of their lives suffering just trying to reach these standards. The ideal body image in this country today seems to be the long haired 5' 7", 110 lb. female found in every fashion magazine and television show. However, many woman at Johns II 5' 7" could starve themselves their entire life and never reach the so called "ideal".( Rushkoff 27). The persuasive and intrusive ... ... dangerous role model, that may even defy their biology, and when this societal and media pressure leads to severe eating disorders among women who believe that they cannot otherwise attain this perceived "ideal" state. The media plays a major role in setting the standard as to what "beauty" is, as the About.com site notes, in finding that, "the average person sees between 400 and 600 ads per day -that is 40 million to 50 million by the time she is 60 years old. One of every 11 commercials has a direct message about beauty." There is abundant evidence that by communicating unhealthy or infeasible goals for appearance, the media can directly cause an increase in eating disorders among women. A Hofstra University research group reported that: "A study examined over 4,000 TV ads. On the average, 1 out of every 3.8 ads had an "attractive-based" message. (www.cdc.gov.nccaphp/teen.html). These results were used to estimate that women are exposed to over 5,000 of these ads a year, (www.cdc.gov.nccaphp/teen.html) and each one adds to women's body dissatisfaction and the desire to be thin and "beautiful."

Sunday, November 10, 2019

Hamlet’s Construction of Sanity Essay

In William Shakespeare’s Hamlet many characters appear to suffer from what appears to be mental instability, most notably Hamlet, Ophelia, and Gertrude. The apparent â€Å"madness† of these characters develops and drives the plot, which results in the play’s tragic ending. It is the reader’s responsibility to decipher which characters are actually mentally ill and which are merely pretending. Furthermore, it is important to keep track of which characters believe other characters are mentally ill. The most important of these is Gertrude, Polonius, and King Claudius’ belief that Hamlet is mad. Gertrude’s suspicion is confirmed by Hamlet’s slaying of Polonius and then shortly after his discussion with the ghost of King Hamlet, whom his mother cannot see. Shortly after the ghost leaves, Hamlet tells his mother, â€Å"No, in despite of sense and secrecy,/Unpeg the basket on the house’s top. /Let the birds fly, and like the famous ape,/To try conclusions, in the basket creep/And break your own neck down† (III. IV. 196-200). In this passage Hamlet instructs his mother to tell King Claudius what has happened. When Claudius discovers the apparent madness of Hamlet this begins a large series of events that leads to the death of all of the main characters. The above passage uses a simile, personification, and a pun to draw the reader’s attention to its importance. The most noteworthy of the figurative language comes in this line, â€Å"Unpeg the basket on the house’s top† (III. IV. 197). The line instructs Gertrude to reveal to Claudius the events that just transpired. However, to â€Å"unpeg† â€Å"the houses top† is a pun, which refers to tricking Claudius (the houses top) into believing that Hamlet is indeed insane. This line is followed by a simile: â€Å"Let the birds fly, and like the famous ape/To try conclusions, in the basket creep† (III. IV. 198-199). According to the footnotes, the story of the famous ape is no longer known, so it is impossible to understand the allusion and what comparison Shakespeare is trying to make. However, it is presumed that the audience of the day would understand the reference. For modern reading it simply shows the reader it is an important passage because of the use of figurative language. In addition, it is important to notice the use of the word â€Å"basket† in this passage. The line, â€Å"Unpeg the basket on the house’s top† (III. IV. 197) appears to be a saying similar to â€Å"letting the cat out of the bag† i. e. revealing a secret or telling Claudius what happened. Moreover, the second use of basket seems to refer to Claudius’s mind or head. This strengthens the pun uses earlier in the â€Å"houses top† by referring to what Claudius is thinking, or should think about Hamlet. The above quote sets up a huge piece of dramatic irony in the play. The audience is aware that Hamlet is not truly insane because they have seen the ghost and understand Hamlet’s intentions. However, Gertrude and Claudius are unaware of this and merely think that Hamlet has gone mad. This prompts Claudius to banish Hamlet and ask the King of England to execute Hamlet upon his arrival in England. Upon Hamlet’s return to Denmark the king makes new plans to kill Hamlet, which results in the deaths of Gertrude, Claudius, Hamlet, and Laertes. The use of figurative language in the above passage helps to drive the dramatic irony in the play. Hamlet wants his uncle, King Claudius to believe he is mad. The line, â€Å"To try conclusions, in the basket creep† (III. IV. 199) refers to Hamlet’s desire to trick Claudius into thinking he is mad. Hamlet wants Claudius to come to the conclusion the Hamlet is insane, although he really is not, so Hamlet can achieve his revenge. This passage is extremely important to the action of the play. These lines set up the action for the rest of the play and incite Claudius, Gertrude, Ophelia, and Laertes to take action in some way or another. It is here that Shakespeare begins to set up for the dramatic denouement where all the main characters die. The actions of Hamlet coupled with the dramatic irony that Shakespeare is establishing make these lines extremely important to the outcome of the play. Shakespeare’s use of figurative language here draws the reader’s attention to the importance of these lines.

Friday, November 8, 2019

Talking With Your Hands. Professor Ramos Blog

Talking With Your  Hands. I’ve always been fascinated with languages, and many times in the past I’ve  tried  to learn. When I was young the first language I tried tackling was Japanese, but I  soon  realized trying to learn a language I was never going to use was, impractical. As  the  years  went by I kept experimenting to see which one might stick. I tried  Russian,German, French, Spanish and while I did take quite a bit from all these  languages, I  never quite found them usable for my daily schedule. Then one day after meeting my  neighbor I had finally found a language that both fascinated me and gave me a  reason to learn. There was a time in my life when I believed I was going to be homeless, but  that  tale is for another time. Long story short, my parents reached out to me when they  heard I was couch hopping and offered to house me as long as I went to college.  Without a second thought I packed my few belongings, went job hunting and  registered for college. At first, I set my major to be horticulture and botanical studies,  but then after two years of being in a job I hated, I finally found a job I hated even  more. Working at a plant nursery. I realized then working with plants as a career just  wasn’t for me and soon after I changed my major to art. Specifically sculpture and  special effects. When I saw how big the competition was to acquire a job in that field  (some people taking as long as 30+ years  just to get recognized) I saw that sculpting  would stay a hobby. I registered for a few  general education classes such as math and  English just to get the credits rolling and I  never really considered language as a  possible career. Around this time I took notice to  my neighbor. I remember taking out the trash one day and looking over to his open garage. He  was talking with his wife, only he wasn’t talking, he was signing. This is when it hit me  that I was living next to a deaf family. I put the trash cans aside and I have no idea  why I  did at the time, but I felt like I needed to introduce myself. I walked over and  Said â€Å"Hi my names Matthew!†Ã‚  He was just  as surprised with me as I  was with myself.  I felt I was over-enunciating  everything, because  subconsciously I felt  like it would  help (it didn’t). He stopped and said â€Å"Hi, I‘m Robert! I’m sorry what was  your name  again? You’re moving your lips all weird†. Bob is kind of portly guy, with a very open personality and he always seems to be  wearing a sports jersey of his favorite teams. He spoke with a muffled almost nasally  accent, which immediately pegged him as a deaf man. While our rapport was great at  first, we quickly found the language barrier and things became a bit awkward. While  I  could understand most of what he said, and he could read lips incredibly well, he  couldn’t  understand most of what I said. It was then when I decided to learn American  Sign Language. At the end of the semester I switched my major (again). I started by  first  learning a few  basic American signs like dog or apple. I would stay up for hours   at  night practicing with  both hands going through each letter of the alphabet   multiple  times. When I drove or walked through a store, I habitually practiced spelling  out  each of the words I saw. I would practice  every sign I knew and I would Google what  the sign was for specific  words I thought I  needed to know. I did this all while I was  waiting for spring classes to start. When the semester began I went through the motions of buying books and  school  supplies, then finally I attended my first ASL class. It was a pretty strange  experience  since I had never taken a language course up until that point. There were  two interpreters  there helping the instructor turn this 3-D language into something  audible for the class to  understand. I was instantly sucked in and terrified at the same  time. I was mesmerized by  the interpreters skill to understand everything being  signed and their seamless ability to make the switch between the two languages. I was  terrified because they were going to  leave after only two days. After that it was going  to be ALL sign Language, so naturally me  and many of the other students  felt  panicked. Although, after the interpreters left I felt this  strange surge of  confidence, I knew this was my calling and it wasn’t going to let it slip  by. I asked every question in the book, I was always the first to raise my hand and  very soon I became noticed by the other students, because instead of asking the  teacher  questions about what sign they should use, they would ask me. The least  qualified person. I saw this as an opportunity to learn, so I would ask the teacher  for  them. After the fastest 3 months of my life I walked from that class  now  conversationally fluent in a new  language. One that didn’t use sound to  communicate an idea, but instead pictures. After passing my first class with flying colors, I gave my neighbor a visit  and  needless to sign (see what I did there) he was blown away. We signed for hours  and  eventually we had to move our conversation to his garage, because it was getting  so dark we couldn’t even see  what we were talking about. He taught me more about  the language in that one moment of us  hanging out than anything I had learned in  my 3 months of being in class. He had shown  me so many different nuances, slang, and inside jokes deaf people used that were part of  the culture, things that simply couldn’t be taught in a classroom setting. This is when it dawned on me  my passion for  language could become a career, learning sign language stopped being  about my  neighbor and soon became about what I could do with my future. When summer came around and class registration opened again, I snatched the  first ASL 2 class I saw and got prepared. Class started and shortly after we finally met  our  new instructor, I noticed right away she was hearing. This somewhat disappointed  me, but  her background was impressive, she had been an interpreter for over 13 years  and had  been involved with the deaf community for even longer. She quickly noticed  my skill  level and took special attention to me. We would sign before and after class,  discussing  different options about interpretation careers and how she got to where she is today.  I still miss her, and I’ll cherish the time I spent in her class. I am now  currently in the next level of ASL Crafton has to offer.  This journey to  literacy in a new  language has changed the way I think and live my life  completely. It’s been proven  that learning a new language literally changes the way you  think.   I now know this to  be true for having experienced it first hand. It creates new  connections, it opens doors  and shows you parts of yourself and the world you might not  have known were there  before.

Wednesday, November 6, 2019

The Ballot or the bullet and its meaning Essays - Free Essays

The Ballot or the bullet and its meaning Essays - Free Essays The Ballot or the bullet and its meaning The Ballot or the bullet and its meaning University of Phoenix ENG/496 Angela Mullennix All of us have suffered here, in this country, political oppression at the hands of the white man, economic exploitation at the hands of the white man, and social degradation at the hands of the white man. (Malcom X, 1964) That is the line that stuck out at the beginning of the speech. Malcom X seemed to be tired of everything that was going on including the bad justice system with the false arrest, the dogs and firehoses, and also the religious aspect being brought into a complex situation that in moments he didnt feel was necessary to bring up. He said in the speech Although I'm still a Muslim, I'm not here tonight to discuss my religion. I'm not here to try and change your religion. I'm not here to argue or discuss anything that we differ about, because it's time for us to submerge our differences and realize that it is best for us to first see that we have the same problem, a common problem, a problem that will make you catch hell whether you're a Baptist, or a Methodist, or a Mu slim, or a nationalist. Whether you're educated or illiterate, whether you live on the boulevard or in the alley, you're going to catch hell just like I am. We're all in the same boat and we all are going to catch the same hell from the same man. He just happens to be a white man. All of us have suffered here, in this country, political oppression at the hands of the white man, economic exploitation at the hands of the white man, and social degradation at the hands of the white man. (Malcom X, 1964) This is a profound speech not only for the content in it but the fact that he seemed to touch on the point of acceptance from everyone. Equal opportunity to be treated as a human. He says Now in speaking like this, it doesn't mean that we're anti-white, but it does mean we're anti-exploitation, we're anti-degradation, and were anti-oppression. And if the white man doesn't want us to be anti-him let him stop oppressing and exploiting and degrading us. He wasnt a racist, but he wanted equality and thats probably the best part I can relate to. From experience it is irritating watching a person walk across the street because they assume I am a criminal, and while some statistics back that fact up it is irritating when I am a educated African American that served my country, so that people can continue to have the freedoms they poses today. I loved this speech, not for its anti-Semitism but for the purpose of it. Work Cited X, M. (1963, April 3). Malcolm X: The Ballot or the Bullet. Retrieved July 27, 2015, from edchange.org/multicultural/speeches/malcolm_x_ballot.html Dixon, E. (2011, January 4). Realism and Modernism, the Black Arts Movement, and Contemporary Literature. Retrieved July 27, 2015, from https://eng351wi2011finalproject.wordpress.com/about/education-and-literacy/realism-and-modernism/

Sunday, November 3, 2019

Performance enhancing drugs in sports (which ones athletes use and the Research Paper

Performance enhancing drugs in sports (which ones athletes use and the benefits and possible side effects of using them) - Research Paper Example Some of them accept athletes as roll models in their life. This is a competitive world and the competition is spread in almost all sectors. By all means, sport is an important part of the competence. For surviving and winning in the competence at the sports field athletes want to maintain and boost their performance more and more. For this reason they always seek the methods for enhancing their performance in competitions and consider drug as the suitable stimuli for achieving their aims. Athletes prefer different types of performance enhancing drugs like anabolic steroids. There are certain reasons behind the use of drugs by athletes. In the book, Drugs in sports, David R. Mottram reveals many important factors related to the use of drugs in sports. In this book he denominates four reasons for the use of drugs in sports. They are listed below. Performance maintenance: - As part of the treatments which occurs at the time of their practicing or some other situation they forced to take treatments. At this time the medicines they took for the sports injuries many include drugs. From the above mentioned four points it is clear that athletes use drugs for improving their performance. Some of the important factors regarding the performance enhancing drugs in sports are discussed below. Almost all kinds of drugs preferred by the athletes contain substances which help the improvement of their athletic performance. It is not a new phenomenon; in the historical period itself athletes prefer drugs for their performance enrichment. It is not limited to one or two types. The most commonly preferred drug types are steroids and amphetamines and health supplements. First two types come under controlled substances, that is its production and distribution are controlled by the legal authority. One of the major reasons for this strict controlling is its high possibility of abuse especially by the athletes and trainers. Health supplements are

Friday, November 1, 2019

Performance appraisal policies Essay Example | Topics and Well Written Essays - 750 words

Performance appraisal policies - Essay Example Walmart, Google and Apple are very reputed companies in the global market and hold a significant place in the list of Fortune 500 companies. Discussing about the performance appraisal of these companies this can be said that Walmart is using performance appraisal system for the purpose of evaluation. The management of this company has set four standards which are below standard, above standard, standard and outstanding performance. According to these levels they are evaluating the productiveness of their employee’s performance in the organizational activities. New joiners are received two times evaluation at the first fiscal year and other employees receive the same one time in a year. Management has decided that all employees should spend at least 6 months at their current position before getting any kind of promotion. The employees who are giving outstanding performance in the organization can receive monetary reward at any time in a financial year. Compensation and benefit are structured according to the performance evaluation of every employees and it can differ from person to person (Armstrong, 2006). Again in case of Apple Inc. this can be said that this company does not provide any kind of guarantee for lifelong employment opportunities without standard performance. So management of this company always focuses on this fact that employees should take responsibilities to achieve target growth to survive in this company. The company has set organization centric goals and target to recruit only qualified and skilled persons in the respective fields. The management of the company is doing performance appraisal of its employees on annual basis and high performers are getting exclusive rewards for their performances. The company is paying a variety of incentives to its employees such as long term care insurance, employee

Wednesday, October 30, 2019

Business Economics 2 Essay Example | Topics and Well Written Essays - 1500 words - 3

Business Economics 2 - Essay Example In other words it is a closed private economy. Households supply labor to firms which in turn pay wages to the former. They buy goods and services produced by the firms. Next we introduce the government. The government is both a producer and a consumer at the same time. It is not only actively involved in production and consumption but also in charging taxes from and giving subsidies to the first two groups. In the next stage we introduce financial institutions such as banks. They enable the flows to be made smoother through their services such as cheques, credit cards and so on. However, still this is a domestic economy, though there are financial institutions in the rest of the world as well. So we finally introduce international trade, i.e. imports and exports. This is where the problem of balance of payments comes up. Balance of payments is the sum total of all imports and exports between a particular country (e.g. Britain) and the rest of the world in monetary terms. Therefore global financial institutions also come into the system. The circular flow diagram, indeed, adequately represents the fact that what is paid by a member of a given sector, say, firms to a member of another sector, say, households, is income for the latter while it’s expenditure for the former. However, in itself it’s a static model of a dynamic series of national and international flows. This is where its inadequacy as a representative model of income flows shows up. The balance of payments problem of Britain or for that matter of any other country is a dynamic one which necessitates a dynamic modeling structure to adequately capture the hidden forces of change. For instance in 2006, Britain’s total exports were equal to  £ 369,691 million while imports were equal to  £ 424,128 million. Thus the current account balance recorded a deficit of  £ 54,437 million in 2006 (Annual Blue Book of Statistics,

Monday, October 28, 2019

Chocolate eassy Essay Example for Free

Chocolate eassy Essay Chocolate is†¦ Well when you think about chocolate you have a joy feeling, and it’s exciting. Not all chocolate is wonderful though, there are many different kinds of chocolate and depending on the type of person you are not all chocolates are enjoyable. You can tell a differences of chocolate by the appearance, smell, texture, flavor, and especially the percent of coca in a chocolate. The coca plays a very important role in chocolate. Coca is cocoa butter and powder mixed which is cocoa solids and it all comes from the cocoa beans, usually found near the equator. In my experiment of tasting and telling differences between chocolates I found the important role coca plays. The difference coca made with 90%-85% coca in a chocolate. The 90% coca was very dark and dull compared to the 85% that was slightly lighter, less dull than the 90% one. The smells for both the 90% and 85% were similar except the 90% chocolate smelled very dull of chocolate just like black coffee as was the taste also, in the 85% coca it was still hardly any smell of chocolate but very mild and the test was more sugary until the black coffee after taste. The texture of all the chocolates felt the same in my hands but in my mouth it was the hardness or easiness of how the chocolate melted, the 90% chocolate did not really melt it was snappy an di had the chew it to break it down, the 85% chocolate started to melt a little bit but I still had to bite to break it down. Now which chocolate would you prefer? Even though the 90%-85% coca wasn’t much of a difference in the amount of coca, it made a difference in taste, but how much of a difference will 70% coca to the 85%-90% make? Now with less coca the chocolate is starting to look like the average Hershey’s bar we get from any store worldwide. Now there’s less coca I get more of a milk chocolate smell but it’s only a little stronger than the 85% coca. This type of chocolate melts or at least it starts to melt in my mouth and is a lot smoother than both the other chocolates. The flavor of this chocolate with only 70% coca is almost like black coffee with sugar but no milk or cream. Out of all the chocolates that were tried so far the 70% would be my pick of a chocolate. Milk chocolate. One of the most common eaten chocolates in the world, but did you know there are different qualities of milk chocolate and they differ from taste, smell, texture, and appearance? Threes the simple generic brand milk chocolate always 35% coca, wow a drop from every other chocolate, right. The generic chocolate is the lightest of all the milk chocolates and the cheapest as well as quality. All the milk chocolates have around the same smell except the generic brand smells duller of milk chocolate but bold of chocolate more than the dark chocolates. The generic chocolate tastes like the cheap Easter candies, or like drown out not really flavored coffee, old and cold coffee. Again 35% coca but a higher quality chocolate, the one and only Hershey’s brand that’s seen on almost every shelf at stores. The appearance in Hershey’s gives you the signature look of chocolate, it’s the darkest of the 3 kinds of quality milk chocolates. This one has the strongest chocolate smell it gives you the memory of that enjoyable taste of CHOCOLATE. Instead of the coffee flavors that every other chocolate has had Hershey taste like how it smells, wonderful. The highest quality of chocolate is less seen and is also more expensive than Hershey. The look is just a little darker than Hershey but has a very distant flavor. There’s more flavorings in the more expensive brands like vanilla milk sugar and any other additives. All the milk chocolates of 35% coca melt in your hand, even though the qualities are different there all 35% and have the same melting temp and have very distinct flavors. The last chocolate that was tried isn’t actually a chocolate but it’s in its name, none other but white chocolate. The looks are completely different it’s white/yellow because there’s eggs and not coca and also only has coco butter in it. It smells like Hershey’s milk chocolate but taste completely different like cream. The white chocolate melts in my mouth still and there are also different qualities of white chocolate. Two other chocolates that were tried are chili chocolate and sea salt chocolate. Both just have additives in it as different flavors and are 47% coca. The two flavors tasted different than any other chocolate because you weren’t just getting the chocolate taste. Although both of the chocolates smelled, had the same appearance and texture as all the other dark chocolates, it tasted very different. My thoughts on this experiment, changed my thinking of chocolate all together I didn’t know that coca could make such a big difference in the taste smell appearance or texture of a chocolate.

Saturday, October 26, 2019

Earthquakes Essay -- Natural Science

Earthquakes Throughout history, man has made many advancements. These advancements have been made to make life easier. The one thing man can't do is to control Mother Nature. Mother Nature can cause many things such as earthquakes. The causes of earthquakes have been theorized in many ways. According to the book Predicting Earthquakes by Gregory Vogt, the Greeks, "blamed the earthquakes on Poseidon, god of the sea"(25). The Hindu believed that "the earth was a platform that rested on the back of eight great elephants. When one of the elephants grew weary, it lowered and shook its head causing the ground above to tremble"(Vogt 25). Margaret Poynter writes "many primitive people thought that the earth rested upon the back of some sort of animal. When that animal became restless, great cracks appeared in the ground, and tall trees swayed and fell. In South America, the animal was a whale. In Japan, it was a great black spider or giant catfish. One ancient tribe thought that four bulls supported the earth on their horns. To amuse themselves, they sometimes tossed it from one to another"(6). In the same book, Poynter says "The Chinese believed that monsters lived in the caves inside the earth. When the creatures fought, the surface of the earth trembled (6)." "In Greece, it was not an animal, but a titan named Atlas who was condemned to support the world upon his shoulders. Later, about the third century B.C., a Greek philosopher, Aristotle, had a more scientific explanation. He thought that earthquakes occurred only when hot air masses tried to escape from the center of the earth. Two centuries later, Lucretius, a Roman, wrote that underground landslides caused the earth's surface to move"(Poynter 7).2 Today, scientists have found a more logical reason to earthquakes. Scientists say almost 600 million years ago, all the continents were connected to form a huge super continent called Pangaea. At about 220 million years ago, Pangaea began to break up into sub-blocks. According to the book Volcanoes, Earthquakes, and the Formation of Continents, these sub-blocks were called "Gondwana (which corresponds approximately to the continents of the present southern hemisphere) and Laurasia (the northern hemisphere)" (Kohler 15). According to Pierre Kohler, "The earth's surface is divided into 13 plates: seven large ones (the largest corresponding to the Pa... ...te long-term predictions of where earthquakes will occur. They know, for example, that about 80 percent of the world's major earthquakes happen along a belt encircling the Pacific Ocean. This belt is sometimes called the Ring of Fire because it has many volcanoes, earthquakes, and other geologic activity" (Earthquakes; Karen C. McNally 38). WORKS CITED Aylesworth, Thomas G. Geological Disasters "Franklin Watts" 1979: 14-15. The New Grolier Multimedia Encyclopedia "Grolier Electronic Publishing Inc." 1993: No Johnson, Thomas P. When Nature Runs Wild "Creative Education Press" 1986: 12-14. Kohler, Pierre Volcanoes Earthquakes and the Formation of Continents "Barron's Educational Series, Inc." 1987: 14-22. Marcus, Rebecca B. The First Book of Volcanoes & Earthquakes "Franklin Watts, Inc." 1972: 62-64. Poynter, Margaret Earthquakes "Enslow Publishers, Inc." 1990: 6-7. Putnam, William C. Geology "Oxford University Press" 1964: 439-450. Vogt, Gregory Predicting Earthquakes "Franklin Watts" 1989: 24-25. Walker, Bryce Earthquakes "Time Life Books" 1982: 94-100. Karen C. McNally Earthquakes World Book Encyclopedia "World Book Inc." 1994: 38-39.

Thursday, October 24, 2019

Metternich System

â€Å"France made its revolutions and gave them their ideas, to the point where a tricolor of some kind became the emblem of virtually every emerging nation, and European (or indeed world) politics between 1789 and 1917 were largely the struggle for and against the principles of 1789, or the even more incendiary ones of 1793. † The principles of the French revolution lived on in every European continent; the French Revolution poured out its ideas and sent shock waves throughout Europe.Therefore this phenomenon together with the period of enlightenment, contributed to the rise of consciousness and of antagonism against the â€Å"Ancien Regime† (a general term for ‘The Old Order’ in Europe before the French Revolution of 1789, when most countries were ruled by absolute monarchs and the aristocracy were the dominant class). The Bourgeoisie class took full advantage of this period to bring across their needs and Ideologies but was rarely at the forefront of the revolution as the peasants were usually causing the riots. The Bourgeoisie played a more underlying role in this revolution.The people within the perimeters of the European wanted nationalism and liberalism. Napoleon Bonaparte also known as the â€Å"little corporal† came and restored stability and glory to France , â€Å"He was the man of the Revolution, and the man who brought stability. † Napoleon brought the French Revolution to its conclusion when he entered the French arena to restore peace by putting an end to the â€Å"Reign of Terror â€Å"and extinguishing the fire of the Bourgeoisie . His megalomaniac personality and ambitious thirst for battles made France a great power in Europe.This was illustrated in the series of battles he won, â€Å"Napoleon fought about sixty battles in his career and won all but a few of them, he rose to power because of his victories and fell because of his defeats. † Metternich’s influence came about before the en d of Napoleon’s regime. â€Å"Metternich was first appointed foreign minister in 1809 the Habsburg Empire was at its lowest point in its struggle against Napoleon. The French leader had forced the Empire out of its northern Italian territories, taken over the Austrian Netherlands and subsumed the Habsburg parts of Poland into the Duchy of Warsaw.Habsburg domination of Germany had also been smashed as a result of the dissolution of the Holy Roman Empire. This was a particularly powerful psychological blow to the dynasty’s sense of self worth: the Habsburgs had been Holy Roman Emperors for almost all of the previous 400 years and suddenly it no longer existed. To add insult to injury, this particular act of Napoleonic modernisation changed the title of the Habsburg Emperor from Francis II, Holy Roman Emperor, to Francis I, Emperor of the remaining Habsburg dominions. One of the few times in history that a monarch has been devalued. Napoleon was defeated in 1815, after w hich the initiative was taken through the employment of the Vienna Congress of 1814-1815, to restore political stability to the fragile European which Napoleon had compromised. The Vienna Congress was chaired by Klemens Wenzel von Metternich, its objective was to address issues which arose out of the French Revolution and the Napoleonic Wars. This settlement lead to the redrawing of the continental map, in so doing establishing new boundaries of France, the Netherlands, Germany, Italian territories and Napoleon’s duchy of Warsaw.In 1815 when Napoleon failed to reassert his influence over Europe, the Congress of Vienna to all intensive purposes coped well with this problem. The Second Treaty of Paris further punished the French by reducing her borders to that of 1790, enforcing a large indemnity on her as well as forcing her to give back the stolen art pillaged from European Cities. This was a just punishment for France who had supported and welcomed Napoleon’s return. Additionally the Congress was against liberalism and nationalism which infiltrated into other European states from the French Revolution which they felt would disrupt their conservatism. First, it was necessary to build a security ring around the recent aggressor, France, and second, to provide the customary cartographical compensation for all the allied partners. † The Congress of Vienna also had to deal with the key matters of containing France, which was accomplished by strengthening those countries on the French border. The Austrian Netherlands was incorporated into Holland, and on France's southern borders, Piedmont, Nice and Savoy became one state.Of course these new single states, not one could contain France by physical presence alone and so the Quadruple Alliance was signed by the major powers for a further 20 years should France rise up again the Congress was very â€Å"lenient† towards France despite the fact that they had just been defeated. Their main purpo se was to restore the â€Å"status quo† and by doing this, they were able to ignore the demands for democracy and nationalism by the French people. Metternich made every effort to remove political or administrative power from local or subordinate levels and oncentrate it in a central authority was illustrated through his opposition of conservatism. He was of the opinion that that social mobility should be based on ascription not on achievement. Metternich was known for his advocation of strong, administratively efficient governmental organization which he felt was successfully portrayed by his ideal form of government the monarchs. This is captured when he said he opposed any other type of government and constitutional change which he felt would inevitably lead to chaos and revolutions.Metternich was aware that all of Europe was conscientious and was aroused easily by the ever present spirit of nationalism and liberalism inherited from the French Revolution. Consequently this is the sole reason for his objection of liberalism and nationalism becoming operational. â€Å"Metternich therefore set his face against any constitutional change. Comparing revolution in turn to a hydra ready to swallow everthing up, to a fire, to a flood, and later to the cholera, hostile to the sovereignty of the people and constitutional government. As such Metternich’s principles opposed the ideology of liberty, equality and fraternity. The spread of Metternich’s ideology throughout Europe he tried to ensure that this objective was not materialized. Another great political idea development by Metternich was the Holy Alliance in 1815; this alliance was created by Tsar Alexander I, members of this alliance included Russia, Austria, and Prussia. The Holy Alliance was implemented to maintain the status quo so that the bourgeoisie were hindered from infiltrating into the upper class.Additionally the Quadruple Alliance of April 22, 1834 formed between Spain, France, B ritian and Portugal, was aimed at ensuring the victory of liberalism, at accomplishing a collective security and protecting the existing peace and balance of power. Social factors is seem as a factor that resulted in the revolutions. The 1820’s revolution damages were widespread as the first bout of unrest was experienced. Revolutionary upheavals began in the Italian states of Naples,Piedmont and Sicily.These revolutions â€Å"occurred because the political systems reimposed on Europe were profoundly, and in a period of rapid social change increasinglyinadequate for the political conditions of the Continent, and because of economic and social discontents were acute as to †¦outbreaks virtually inevitable. † They felt that the Metternich system disregarded their desire for liberalism and nationalism. In 1818, the church was restored to supremacy, regaining its influencial power in Naples this angered the people and the resentment against the leadership grew.The libe rals were inciting members of society to stage revolutions in efforts to gain freedom and oppose the leadership of the Kings whose rulings reflected the ideologies of the Metternich system. A proletarian and socialist revolutionary movement â€Å"was chiefly visible in the countries of the dual revolutions, Britian and France. † The most notably results of 1830’s revolution was the â€Å"modifications of left-wing politics. They split moderates from radicals and they created a new international situation. In doing so they helped to split the movement not only into different social but into different national segments. The 1820’s and the 1830’s revolution both failed miserably because of little cooperation among the revolutionary movement and due to isolation of territories which preferred to stay alienated instead of forming union between the territories. The economic factors must now be considered, Metternich’s system amended the administration t hroughout Europe. As such the changes fostered by the Vienna Congress in particular was a major handicap for some countries. The Vienna Congress rulings were catastrophic to France who had to repatriate seven million francs and relinquish some colonies from the Italian providences to Austria.Primarily because of the personal interest Metternich had in Austria such drastic effects were taken, therefore it can be stated that the major powers of the Vienna Congress made decisions to their individual advantage. Germany was another state who suffered immense losses just as France in efforts to settle international disputes. The territories bought economic stability as it increased the size of their purses and their power on the international arena. The Metternich system assisted in the financial prosperity of some nations while it crippled the acquisition of economic stability of other imperial powers.Metternich fetish of restoring the monarchy of many countries was a financial burden on many countries whose desire was to be included in this grand change. The economic hardships were responsible for many of the revolutions in Europe both before and after the Metternich’s rule. The congress of Aix-La Chapelle in 1818 had a major concern about what should be done with France in terms of allowing them to attend future congress meetings and more importantly if they should relieve them of their military occupation.The congress came to a unanimous decision on both issues where they allowed France to return to future meetings and the military occupation would end. â€Å"Metternich also frustrated Russian hopes of facilitating a Franco-Russian alliance as a counter to the Austrian-British alignment. He achieved this by sowing the seeds of mistrust between the two powers. The Congress of Aix-La-Chapelle therefore coped well with the problem facing it in 1818. † There was another meeting in 1820 that took place in Troppau which was convened to discuss the matter s about the uprising In Spain and Naples.Each of the main powers at the congress had a different view about how the matter should be handled. Metternich made the decision to take action in Naples as it posed a great threat to Austrian influence in Italy. Alexander who represented Russia at the congress wanted to send troops into Spain to restore the monarchy (Ferdinand) while Casltereagh (Britain) thought that Naples and Spain were continental problems and as a result were not a concern of the British.The end result was the signing of the Troppau protocol which was a great success for Metternich as he gained the support of Russia and isolated France. As Metternich gained the support of Russia, he somewhat lost the support of the British. â€Å"However on the whole the congress system itself had failed to cope with the problems of Spain and Naples. The question of Spain would remain a problem even after the Congress of Verona in 1822, and the Troppau agreement had split the major po wers in two. The system could not cope without a general agreement by all the major powers.The main problem was, all the major powers had differing opinions and interests, which made certain a general agreement on a course of action was unlikely. Without such an agreement time would run out on the lifeline of the system. † The Congress met for the last time in Verona, 1822 to discuss the fact that Spain was still facing problems and there was a revolution that was taking place in Greece as well. â€Å"It might seem as though the Congress had coped well with the problems it faced but this is misleading.The Spanish problem, had been a problem since 1820 and was still not solved. Metternich who had pressed for the signing of the Troppau protocol would still not summon action to be taken. † The congress system finally met its end in 1822. Some historians have argued that the system itself was a failure, however in my opinion this was not the case. Metternich accomplished a lot during his time such as his defeat of Napoleon and the formation of the Vienna Congress. â€Å"The Congresses stretching from Vienna to Verona had to contend with a number of issues and t was not surprising given the nature of the system itself that certain problems would split the powers in attendance. After all the motivation behind the creation of the Congress Meeting was to deal with France, and not to deal with revolutionary uprisings. How could the Congress system deals with problems it was not designed to face. † There were multiple views on all of issues which arose after 1818 and up to 1822 could not be accommodated. At Vienna and Aix La Chappelle the powers in attendance came to a general agreement, but there would be a time when no such agreement would be possible.This can be seen with the Troppau protocol which split the powers in two. â€Å"After the congress of Troppau time was effectively running out on the life line of the congress system. Britain no long er wanted to be involved in continental affairs that did not concern her directly and the other European powers had a mutual suspicion of one another's ambitions and interests. Forces of political intrigue were working behind the scenes to isolate powers and force an agreement on a certain course of action. †