Gold In Grendel Essays - Beowulf, Grendel, Parallel Literature

Gold In Grendel Gold has many different uses. In John Gardner's novel Grendel, it is used as a motif to symbolize different aspects of a character. Though it has a constant meaning throughout the novel, it also differs according to each character. Gardner uses gold as a symbol of majesty as well as protection, greed and power throughout the novel especially related to the characters of the Shaper, Hrothgar and the Dragon respectively. To the Shaper, gold symbolizes majesty as well as protection. He was ?beyond the need of any shaggy old gold-friend's pay (49).? The Shaper did not merely work to earn his gold; he sang his songs of old because they were his passion and his love. The king supported him, and that was all he needed. He had no desire to obtain the gold, and in turn, he gained more. The gold was also his protector. At the time of his death, the women covered his eyes with gold to keep him from seeing where he went (145). It protected him from seeing the corruption and greed in society. Because of this protection, he was able to keep his focus on the inspiration of his songs. Then there is Hrothgar, to whom gold symbolizes majesty as well as greed. During the wars between the various kings, they threaten to steal each other's gold and burn the meadhalls (33). The gold became a symbol to the people of who was the stateliest ruler between the Danes. The gold became their supremacy. To Hrothgar, as well as the other kings, their gold symbolizes their greed for the other's kingdom and the other's wealth. Hrothgar coveted the gold of other kings and made it his quest to control what he wanted. Even his own sons did not care about their father. They merely weighed his worth by how much gold he possessed (53). Their greed for power outweighed their desire for justice in ruling. They only wanted money. To the Dragon, gold symbolizes majesty and power over humans. Gardner first describes the Dragon as ?vast and red-golden? with tusks that shimmered as if they were made of gold(57). The dragon is very prestigious. He has the demeanor of a ruler. He understands and he knows the future and sees that as a form of power and control over everything. He persuades Grendel to attack the humans because he knows that he will do it anyway(69). The dragon also knows that he will also perish, so he wants to gather all the gold that he can to display his power while he still lives. For, unlike Grendel, he ?covets gold, not souls (1).? Gold can mean different things to different individuals. To some, like the Shaper, it can cover their eyes from corruption. Yet, for others, like the Dragon and Hrothgar, it can become the source of their corruption. Everything depends on what their desire is. English Essays

Capital City of Canada Why Ottawa

Capital City of Canada Why Ottawa SAT / ACT Prep Online Guides and Tips Whether you’re preparing for a geography exam or simply want to learn more about your friendly neighbor to the north, we’ve got you covered. In this guide, we'll answer an important question everyone should know the answer to: what is the capital of Canada?In addition, we'll explain how this place came to be the capital city of Canada and what all the capital cities of the Canadian provinces and territories are currently. What Is the Capital of Canada? The capital of Canada is Ottawa, which is located in Ontario- that is,the province directly above the Great Lakes and the US states of Minnesota, Wisconsin, Michigan, Ohio, and (part of) New York. Ottawalies on the south bank of the Ottawa River, which runs between and defines the borders of the provinces Ontario and Quebec. Opus Penguin/Flickr Together, Ottawa and the city of Gatineau, which is located directly across from Ottawa in Quebec, make up the National Capital Region called Ottawa-Gatineau. This specially designated region refers to not only the cities themselves but also their surrounding Census Metropolitan Areas. Due to Ottawa’s placement between the primarily English-speaking Ontario and the mostly French-speaking Quebec, it is one of the most bilingual cities in Canada. Beloware some quick facts to know about Ottawa, the capital city of Canada: Location: Southeastern Ontario Original Settlers: Odawa tribe ("Odawa" is said to mean "traders") in the mid-17th century Population (2016): 989,567 (Ottawa-Gatineau) Population Rank (2016): Sixth-largest city in Canada (Ottawa-Gatineau) Year Established: 1850 as town of Bytown, 1855 as city of Ottawa Climate: Continental, with warm summers (70℉) and cold winters (15℉) Major Employer: Federal government Landmarks: Parliament Hall, ByWard Market, National Gallery of Canada, Rideau Canal, University of Ottawa Closest US State: New York Closest Big City: Montreal in Quebec A Brief History of the Capital of Canada Ottawa has been the capital city of Canada ever since Canada became a self-governing country. But how exactly did it manage to become the capital of Canada- and why? In 1841, what was originally called the Province of Canada (the present-day provinces of Ontario and Quebec) came under British colonial control. The next 16 years witnessed ongoing disputes over what the capital of the new province should be; contenders included Quebec City, Toronto, Montreal, Kingston, and finally Ottawa. Each of these cities held the title of capital of Canada for varying lengths of time. Here is a chronology of exactly how the capital city of Canada changed in just two and a half decades: Kingston (1841-1844) Montreal (1844-1849) Toronto (1849-1851) Quebec City (1851-1855) Toronto (1855-1859) Quebec City (1859-1865) Ottawa (1866-present) It was clear already by 1857 that the decision of where to place the capital of Canada was going to be difficult and time-consuming. At this time, Queen Victoria was asked to select the capital city of Canada. Her choice of Ottawa- a fairly small and newly incorporated city- surprised many. Still, Ottawa had a lot of promise: it was starting to experience economic growth and was home to an impressive railway system; it also had a long history of trade due to its location near several rivers. Butnot everyone agreed with the queen’s pick,which led Toronto to remain the capital for another two years followed by Quebec City for another six years. It wasn’t until 1866 that Ottawa was officially designated the capital city of the Province of Canada and began to hold Parliament. In 1867, the Province of Canada became the Dominion of Canada, making it an official, self-governing colony of the British empire. This also meant that Ottawa was the first (and so far only) official capital of Canada as we know it. What Are the Capital Cities of Canada? We now know that Ottawa is the capital city of Canada, but what about the capital cities of all the provinces and territories within Canada? Similar to the United States, where there is a capital city for each state, Canada has capital cities for all 13 of its provinces and territories. The following chartdepicts the capital city of each Canadian province/territory and its population from the 2016 census. Provinces and territories are listed alphabetically. Province/Territory Capital City Capital City Population (2016) Provinces - - Alberta Edmonton 932,546 British Columbia Victoria 85,792 Manitoba Winnipeg 705,244 New Brunswick Fredericton 58,220 Newfoundland and Labrador St. John’s 108,860 Nova Scotia Halifax 403,131 Ontario Toronto 2,731,571 Prince Edward Island Charlottetown 36,094 Quebec Quebec City 531,902 Saskatchewan Regina 215,106 Territories - - Northwest Territories Yellowknife 19,569 Nunavut Iqaluit 7,740 Yukon Whitehorse 25,085 Note that while the capital city of Canada (Ottawa) is located in Ontario, it is notthe capital of Ontario itself- thisstatus belongs to Toronto. For most provinces/territories in Canada, the capital city is also the most populated city, but this isn’t always the case. Here are the biggest cities for the Canadian provinces for which the capital city is not the most highly populated: Province Biggest City City Population (2016) Alberta Calgary 1,239,220 British Columbia Vancouver 631,486 New Brunswick Saint John 67,575 Quebec Montreal 1,704,694 Saskatchewan Saskatoon 246,376 What’s Next? Are you taking the IB geography class? Then you might want some tips and resources with our comprehensive guide. Preparing for the AP Human Geography exam?Get an overview of what's on the test and then learn the best ways to study for it. You can also check out our expert picks for the best AP Human Geography prep books.

Observing K-3 Science Activities & Observing K-3 Math Activities Coursework

Observing K-3 Science Activities & Observing K-3 Math Activities - Coursework Example For instance, increasing their proficiency would mean sitting down them individually or in small groups and explaining the concepts to them through real-life methodology. Collaborating is undoubtedly essential in order to thrive in any profession as the thoughts of ideas, knowledge, and practices are exchanged. Quite often, students struggle to socialize in a pre-dominant learning environment as I witnessed this first hand. Whiteboards, technical stimulation were used. In addition, an application was used to teach children in a better manner so their minds can be stimulated. This was crucial to their learning development because the kids interacted with it. g. What types of questions were used during the lesson? What research-based strategies are being used to promote critical and higher order thinking? Content area vocabulary? Do the techniques and strategies used promote diversity, openness, inquiry, and support? Many open-ended questions were utilized to answer these questions. First and foremost, kids were given problems that they needed to solve in a highly skilled manner. Additionally, students were propagated to promote critical thinking by thinking outside the box. I like the fact that they can use other techniques instead of boring drills. Yes, I think they do promote openness and the desire to learn. The purpose of education is to ensure that students become good moral citizens of society and make sound decisions that can facilitate humanity. It is clear to point out those morals such honesty, integrity, and morals are derived from important nurture. Another purpose of education is to collaborate and engage in peer tutoring. Peer tutoring is an essential learning tool because it facilitates the process of collaboration and writing a social artifact. Peer tutoring is an extremely innovate idea since it combines collaborative and cognitive learning as students learned from tutors and tutors

A managerial approach to marketing Essay Example | Topics and Well Written Essays - 2250 words

A managerial approach to marketing - Essay Example Competitive pressures to deliver specific products to meet consumer demand have changed the way the products move from the producer to the consumer. Any company has to adopt new marketing strategies in order for it to survive in the ever competing environment. The marketing landscape has shifted in that technological innovation, new channels, regulatory compliance, bottom-line accountability and rising customer expectations are altering the playing field. Marketing managers are unraveling these complexities in order to spearhead initiatives that capitalize on the customer-driven market place. It is important to place the customer at the core of strategic decision making hence marketing managers can better align marketing resources, spend, mix and technology investments. Strategy and technology can then coalesce to profitably meet customers’ needs, which enhance brand performance, increase customer value and position the enterprise for growth capability of outpacing competitors. This strategic brief addresses central issues on the minds of today’s marketing managers. As technology advances and consumers gain clout, traditional batch and blast marketing approaches designed to maximize new customer acquisition without regard for customer needs and long-term value will under perform. Launching marketing programs around new products for short-term revenue wins will not be enough to sustain returns and surpass competitors. Technological innovations are constantly altering the playing field. Analytic solutions are bringing new levels of customer intelligence, allowing marketers to understand individual customer needs. Optimization tools have increased marketing velocity and shortened cycle times. Consolidated, clean customer data stores can be matched with event-based campaign management tools to improve message accuracy, timeliness and relevancy. As technologies come to

The Greeks and Philosophy Research Paper Example | Topics and Well Written Essays - 1500 words

The Greeks and Philosophy - Research Paper Example For, â€Å"†¦without any assistance of sense, and perseveres until by pure intelligence he arrives at the perception of the absolute good, he at last finds himself at the end of   the intellectual world, as in the case of sight at the end of the visible.†2 Philosophy is about finding points that will lead one to theorize. Philosophy includes â€Å"†¦steps and points of departure into a world which is above hypotheses, in order that she may soar beyond them to the first principle of the whole†¦Ã¢â‚¬ 3 â€Å"Until the person is able to abstract and define rationally the idea of good, and unless he can run the gauntlet of all objections, and is ready to disprove them, not by appeals to opinion, but to absolute truth, never faltering at any step of the argument --unless he can do all this, you would say that he knows neither the idea of good nor any other good; he apprehends only a shadow, if anything at all, which is given by opinion and not by science; --drea ming and slumbering in this life, before he is well awake here, he arrives at the world below, and has his final quietus.†4 For Plato, what equaled philosophy included the truth. â€Å"And I thought that I had better have recourse to ideas, and seek in them the truth of existence.†5 Naturally, the most logical thoughts that were reinforced as correct were what Plato considered philosophy, saying that â€Å"†¦I first assumed some principle which I judged to be the strongest, and then I affirmed as true whatever seemed to agree with this, whether relating to the cause or to anything else; and that which disagreed I regarded as untrue.†6 True philosophy, after all, lies â€Å"†¦in [the] asking and answering questions†¦Ã¢â‚¬ 7 Rejecting the false and embracing the truth seems to have been what Plato was searching for all the time in his dialogues. The process of philosophy was about digging into the psyche to find a deeper truth. The process involves lots of rational thinking, evaluation, and critical thinking skills. Not only that, but Plato’s ideas of philosophy held fast to the ideas that what was good and virtuous were things that were worth philosophizing about. This process of parsing out what was good and virtuous in itself was worth it to Plato to take great pains to try to explain—in detail—what was worth expounding upon in his dialogues. Plato consistently maintained that philosophy was a constant search for that which was real, good, true, and reliable—versus that which was fake or a facade, bad, untrue, or inconsistent. Constistency is what made Plato such an emblematic figure in philosophy, because one knew what to expect from his type of logic. Therefore, his points were not only true but rational. B) Find at least two passages in the dialogues that were covered in this module where Plato shows Socrates entering into the dialectical process of Philosophy. Copy and paste the passages usi ng quotation marks and cite the source dialogue. You find two passages where Socrates is exchanging questions and answers with someone on a topic, issue or question. Where do you find these passages? Find them in any of these dialogues: ION EUTHYPHRO APOLOGY CRITO PHAEDO REPUBLIC SYMPOSIUM ?DO NOT USE THE SEVEN PASSAGES SUPPLIES IN PART A THAT DESCRIBE DIALECTICS! Those passages are not demonstrations of the process but are descriptions of it. How long do they need to be? Not the entire dialogue! Just submit a passage long enough to see the back

Comparison of Techniques for Diagnosis of Multiple Sclerosis

Comparison of Techniques for Diagnosis of Multiple Sclerosis Background: There is increased need to develop specific biomarkers for multiple sclerosis (MS) to aid in the diagnosis, improve the management of patients and the monitoring of the effectiveness of treatment. Oligoadenylate synthetase 1 (OAS1) is up regulated by type 1 interferon. A single nucleotide polymorphism (SNP) in exon 7 of OAS1 results in differential enzyme activity. Objective: To correlate different OAS1 genotypes, in patients with relapsing remitting multiple scleroses (RRMS) under interferon-beta (IFN ÃŽ ²) therapy, with disease activity. Subjects and Methods: OAS1 genotype was assessed in 20 patients with RRMS and 20 age and gender matched healthy controls. All patients were medicated with IFN ÃŽ ². The patients were subdivided in terms of disease activity assessed by Expanded Disability Status Scale (EDSS), in two groups; group I with minimal disease activity and group II with severely active disease. All patients were followed up every 6 months for a period of 2 years . Results: Genotyping analysis of the OAS1 gene revealed a significant difference between RRMS patients and control group, with lower frequency of GG in patients (25%) compared to controls (65 %) (p = 0.0001). Furthermore, AA genotype was detected 35% of patients compared to 0% in controls (p = 0.01). Regarding disease activity, AA genotype had a significantly higher frequency (71.4%) in patients with severely active disease compared to 15.4% in patients with minimally active disease (p=0.0001). Conclusions: The A-allele is considered risky and the G is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity. Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system, the etiology and pathogenesis of which remain largely elusive. The most common form of MS is the relapsing–remitting form (RRMS), in which episodes of acute worsening of neurological function (relapses) are followed by partial or complete recovery periods (remissions) free of disease progression.1,2 Type 1 interferons (IFNs) are innate immune cytokins that activate the JAK/Stat signaling pathway leading to induction of IFN-stimulated genes. The 2,5-OAS family is central to the IFN antiviral pathway for viruses whose replication includes production of double-stranded RNA. One member of this family of proteins, OAS1, induces RNAseL, resulting in degradation of viral RNA, inhibition of virus replication, and promotion of cellular apoptosis.1 Several OAS1 polymorphisms have been reported; one located at the exon 7 splice-acceptor site results in alternative splicing of the OAS1 mRNA. Although clinical trials have proven the efficacy of interferon-beta (IFN ÃŽ ²) in the treatment of RRMS2-4, over one-third of patients have continuing significant disease activity.5 On purely clinical grounds, patients have variously been considered to have responded poorly, based on relapse occurrence6-9 or on disability progression while receiving IFN ÃŽ ² therapy.10 Therefore, cohorts of patients receiving IFN ÃŽ ² can be informative for evaluating general determinants of disease activity. Aim of work: to examine the relationship between OAS1 genotype and indices of disease activity in RRMS under IFN ÃŽ ² therapy. Subjects and Methods Twenty patients with RRMS according to revised McDonald criteria11 were enrolled from an outpatient and inpatient population attending Neurology Department, Tanta University Hospital. Twenty unrelated age- and gender-matched volunteers, with no history of MS or other neurologic disease, were recruited as a control group. All patients received IFNÃŽ ² therapy and followed up every 6 months over a period of 2 years from January 2010 to January 2012. The Ethics Committee of Hospital approved the study, and a written informed consent was obtained from each participant. For all patients, baseline data collected included disease duration, age at onset, relapse history prior to therapy, and clinical disability measured using the Expanded Disability Status Scale (EDSS).12 Relapses were defined as an episode of neurologic disturbance lasting for at least 24 hours and not caused by a change in core body temperature or infection.13 Disability progression was defined as an increase in EDSS score by 1 point from baseline confirmed at 6 months.5 Genomic DNA was isolated from peripheral blood samples. Primers were designed to specifically amplify a 347-bp product surrounding the rs10774671 SNP. A total of 5 grams of genomic DNA was amplified by PCR. Primer sequences used were; rs 10774671 – forward, TCCAGATGGCATGTCACAGT and reverse, AGAAGGCCAGGAGTCAGGA. Amplification conditions included initial denaturation at 94 centigrade for 2 minutes, followed by 28 cycles at 94 centigrade for 20 seconds, 62 centigrade for 40 seconds 72 centigrade for 30 seconds, with a final extension for 7 minutes at 72 centigrade. The PCR products were digested with the ALU1 restriction enzyme. Digested products were analyzed by agrose gel electrophoresis and genotypes were assigned, the A-allele coding for a truncated form with low activity and the G conferring high enzymatic activity. Patients were assigned to 1 of 2 groups. Group I included minimal disease activity; patients who experienced a maximum of 1 relapse after 24 months of IFNÃŽ ² therapy and had no sustained disability progression. Group II included a severely active disease; patients who had 2 or more relapses on IFNÃŽ ² therapy over 24 months with or without sustained disability progression.14 Statistical Analysis SPSS 10 was used for data analysis.15 P value

media Essay -- essays research papers

Media Manipulation There is a very subtle, yet powerful force at work on our world today. It is trying to control what woman and young girls do say and believe, especially about their own appearances. The media portrays unrealistic images that affect the way people, particularly woman, feel about themselves. And there is no way to avoid it. The media acts as a transmitter of potentially dangerous, socially desirable values and norms. Anyone can become a victim without even realizing it. Woman are told to believe distortions, inaccuracies, and bias on a daily basis. Somehow in that all the madness thinness has become synonymous with attractiveness. It is the media's job to surround us with slogans and pictures that are able to etch themselves into brains. (Stevens 44) Television, movies, magazine ads, commercials and billboards all attribute to the growing influence the media has on women. (www.rethinkingschools.org). Young girls are the most influenced by the media and its manipulation.(www.ed.gov .ERIC...). However, society as well as the media, has put forth dangerous and concentrated images, that have a strong impact on the lives of woman of all ages. Society has always placed a great emphasis upon the importance of a woman's appearance, and through that emphasis woman have been taught to measure their self worth in terms of the image they present, even more so than their own intelligence. They have been given rigid and challenging standards to live up to, standards that are usually unrealistic, unattainable, and disheartening. Many woman spend the majority of their lives suffering just trying to reach these standards. The ideal body image in this country today seems to be the long haired 5' 7", 110 lb. female found in every fashion magazine and television show. However, many woman at Johns II 5' 7" could starve themselves their entire life and never reach the so called "ideal".( Rushkoff 27). The persuasive and intrusive ... ... dangerous role model, that may even defy their biology, and when this societal and media pressure leads to severe eating disorders among women who believe that they cannot otherwise attain this perceived "ideal" state. The media plays a major role in setting the standard as to what "beauty" is, as the About.com site notes, in finding that, "the average person sees between 400 and 600 ads per day -that is 40 million to 50 million by the time she is 60 years old. One of every 11 commercials has a direct message about beauty." There is abundant evidence that by communicating unhealthy or infeasible goals for appearance, the media can directly cause an increase in eating disorders among women. A Hofstra University research group reported that: "A study examined over 4,000 TV ads. On the average, 1 out of every 3.8 ads had an "attractive-based" message. (www.cdc.gov.nccaphp/teen.html). These results were used to estimate that women are exposed to over 5,000 of these ads a year, (www.cdc.gov.nccaphp/teen.html) and each one adds to women's body dissatisfaction and the desire to be thin and "beautiful."

Hamlet’s Construction of Sanity Essay

In William Shakespeare’s Hamlet many characters appear to suffer from what appears to be mental instability, most notably Hamlet, Ophelia, and Gertrude. The apparent â€Å"madness† of these characters develops and drives the plot, which results in the play’s tragic ending. It is the reader’s responsibility to decipher which characters are actually mentally ill and which are merely pretending. Furthermore, it is important to keep track of which characters believe other characters are mentally ill. The most important of these is Gertrude, Polonius, and King Claudius’ belief that Hamlet is mad. Gertrude’s suspicion is confirmed by Hamlet’s slaying of Polonius and then shortly after his discussion with the ghost of King Hamlet, whom his mother cannot see. Shortly after the ghost leaves, Hamlet tells his mother, â€Å"No, in despite of sense and secrecy,/Unpeg the basket on the house’s top. /Let the birds fly, and like the famous ape,/To try conclusions, in the basket creep/And break your own neck down† (III. IV. 196-200). In this passage Hamlet instructs his mother to tell King Claudius what has happened. When Claudius discovers the apparent madness of Hamlet this begins a large series of events that leads to the death of all of the main characters. The above passage uses a simile, personification, and a pun to draw the reader’s attention to its importance. The most noteworthy of the figurative language comes in this line, â€Å"Unpeg the basket on the house’s top† (III. IV. 197). The line instructs Gertrude to reveal to Claudius the events that just transpired. However, to â€Å"unpeg† â€Å"the houses top† is a pun, which refers to tricking Claudius (the houses top) into believing that Hamlet is indeed insane. This line is followed by a simile: â€Å"Let the birds fly, and like the famous ape/To try conclusions, in the basket creep† (III. IV. 198-199). According to the footnotes, the story of the famous ape is no longer known, so it is impossible to understand the allusion and what comparison Shakespeare is trying to make. However, it is presumed that the audience of the day would understand the reference. For modern reading it simply shows the reader it is an important passage because of the use of figurative language. In addition, it is important to notice the use of the word â€Å"basket† in this passage. The line, â€Å"Unpeg the basket on the house’s top† (III. IV. 197) appears to be a saying similar to â€Å"letting the cat out of the bag† i. e. revealing a secret or telling Claudius what happened. Moreover, the second use of basket seems to refer to Claudius’s mind or head. This strengthens the pun uses earlier in the â€Å"houses top† by referring to what Claudius is thinking, or should think about Hamlet. The above quote sets up a huge piece of dramatic irony in the play. The audience is aware that Hamlet is not truly insane because they have seen the ghost and understand Hamlet’s intentions. However, Gertrude and Claudius are unaware of this and merely think that Hamlet has gone mad. This prompts Claudius to banish Hamlet and ask the King of England to execute Hamlet upon his arrival in England. Upon Hamlet’s return to Denmark the king makes new plans to kill Hamlet, which results in the deaths of Gertrude, Claudius, Hamlet, and Laertes. The use of figurative language in the above passage helps to drive the dramatic irony in the play. Hamlet wants his uncle, King Claudius to believe he is mad. The line, â€Å"To try conclusions, in the basket creep† (III. IV. 199) refers to Hamlet’s desire to trick Claudius into thinking he is mad. Hamlet wants Claudius to come to the conclusion the Hamlet is insane, although he really is not, so Hamlet can achieve his revenge. This passage is extremely important to the action of the play. These lines set up the action for the rest of the play and incite Claudius, Gertrude, Ophelia, and Laertes to take action in some way or another. It is here that Shakespeare begins to set up for the dramatic denouement where all the main characters die. The actions of Hamlet coupled with the dramatic irony that Shakespeare is establishing make these lines extremely important to the outcome of the play. Shakespeare’s use of figurative language here draws the reader’s attention to the importance of these lines.

Talking With Your Hands. Professor Ramos Blog

Talking With Your  Hands. I’ve always been fascinated with languages, and many times in the past I’ve  tried  to learn. When I was young the first language I tried tackling was Japanese, but I  soon  realized trying to learn a language I was never going to use was, impractical. As  the  years  went by I kept experimenting to see which one might stick. I tried  Russian,German, French, Spanish and while I did take quite a bit from all these  languages, I  never quite found them usable for my daily schedule. Then one day after meeting my  neighbor I had finally found a language that both fascinated me and gave me a  reason to learn. There was a time in my life when I believed I was going to be homeless, but  that  tale is for another time. Long story short, my parents reached out to me when they  heard I was couch hopping and offered to house me as long as I went to college.  Without a second thought I packed my few belongings, went job hunting and  registered for college. At first, I set my major to be horticulture and botanical studies,  but then after two years of being in a job I hated, I finally found a job I hated even  more. Working at a plant nursery. I realized then working with plants as a career just  wasn’t for me and soon after I changed my major to art. Specifically sculpture and  special effects. When I saw how big the competition was to acquire a job in that field  (some people taking as long as 30+ years  just to get recognized) I saw that sculpting  would stay a hobby. I registered for a few  general education classes such as math and  English just to get the credits rolling and I  never really considered language as a  possible career. Around this time I took notice to  my neighbor. I remember taking out the trash one day and looking over to his open garage. He  was talking with his wife, only he wasn’t talking, he was signing. This is when it hit me  that I was living next to a deaf family. I put the trash cans aside and I have no idea  why I  did at the time, but I felt like I needed to introduce myself. I walked over and  Said â€Å"Hi my names Matthew!†Ã‚  He was just  as surprised with me as I  was with myself.  I felt I was over-enunciating  everything, because  subconsciously I felt  like it would  help (it didn’t). He stopped and said â€Å"Hi, I‘m Robert! I’m sorry what was  your name  again? You’re moving your lips all weird†. Bob is kind of portly guy, with a very open personality and he always seems to be  wearing a sports jersey of his favorite teams. He spoke with a muffled almost nasally  accent, which immediately pegged him as a deaf man. While our rapport was great at  first, we quickly found the language barrier and things became a bit awkward. While  I  could understand most of what he said, and he could read lips incredibly well, he  couldn’t  understand most of what I said. It was then when I decided to learn American  Sign Language. At the end of the semester I switched my major (again). I started by  first  learning a few  basic American signs like dog or apple. I would stay up for hours   at  night practicing with  both hands going through each letter of the alphabet   multiple  times. When I drove or walked through a store, I habitually practiced spelling  out  each of the words I saw. I would practice  every sign I knew and I would Google what  the sign was for specific  words I thought I  needed to know. I did this all while I was  waiting for spring classes to start. When the semester began I went through the motions of buying books and  school  supplies, then finally I attended my first ASL class. It was a pretty strange  experience  since I had never taken a language course up until that point. There were  two interpreters  there helping the instructor turn this 3-D language into something  audible for the class to  understand. I was instantly sucked in and terrified at the same  time. I was mesmerized by  the interpreters skill to understand everything being  signed and their seamless ability to make the switch between the two languages. I was  terrified because they were going to  leave after only two days. After that it was going  to be ALL sign Language, so naturally me  and many of the other students  felt  panicked. Although, after the interpreters left I felt this  strange surge of  confidence, I knew this was my calling and it wasn’t going to let it slip  by. I asked every question in the book, I was always the first to raise my hand and  very soon I became noticed by the other students, because instead of asking the  teacher  questions about what sign they should use, they would ask me. The least  qualified person. I saw this as an opportunity to learn, so I would ask the teacher  for  them. After the fastest 3 months of my life I walked from that class  now  conversationally fluent in a new  language. One that didn’t use sound to  communicate an idea, but instead pictures. After passing my first class with flying colors, I gave my neighbor a visit  and  needless to sign (see what I did there) he was blown away. We signed for hours  and  eventually we had to move our conversation to his garage, because it was getting  so dark we couldn’t even see  what we were talking about. He taught me more about  the language in that one moment of us  hanging out than anything I had learned in  my 3 months of being in class. He had shown  me so many different nuances, slang, and inside jokes deaf people used that were part of  the culture, things that simply couldn’t be taught in a classroom setting. This is when it dawned on me  my passion for  language could become a career, learning sign language stopped being  about my  neighbor and soon became about what I could do with my future. When summer came around and class registration opened again, I snatched the  first ASL 2 class I saw and got prepared. Class started and shortly after we finally met  our  new instructor, I noticed right away she was hearing. This somewhat disappointed  me, but  her background was impressive, she had been an interpreter for over 13 years  and had  been involved with the deaf community for even longer. She quickly noticed  my skill  level and took special attention to me. We would sign before and after class,  discussing  different options about interpretation careers and how she got to where she is today.  I still miss her, and I’ll cherish the time I spent in her class. I am now  currently in the next level of ASL Crafton has to offer.  This journey to  literacy in a new  language has changed the way I think and live my life  completely. It’s been proven  that learning a new language literally changes the way you  think.   I now know this to  be true for having experienced it first hand. It creates new  connections, it opens doors  and shows you parts of yourself and the world you might not  have known were there  before.

The Ballot or the bullet and its meaning Essays - Free Essays

The Ballot or the bullet and its meaning Essays - Free Essays The Ballot or the bullet and its meaning The Ballot or the bullet and its meaning University of Phoenix ENG/496 Angela Mullennix All of us have suffered here, in this country, political oppression at the hands of the white man, economic exploitation at the hands of the white man, and social degradation at the hands of the white man. (Malcom X, 1964) That is the line that stuck out at the beginning of the speech. Malcom X seemed to be tired of everything that was going on including the bad justice system with the false arrest, the dogs and firehoses, and also the religious aspect being brought into a complex situation that in moments he didnt feel was necessary to bring up. He said in the speech Although I'm still a Muslim, I'm not here tonight to discuss my religion. I'm not here to try and change your religion. I'm not here to argue or discuss anything that we differ about, because it's time for us to submerge our differences and realize that it is best for us to first see that we have the same problem, a common problem, a problem that will make you catch hell whether you're a Baptist, or a Methodist, or a Mu slim, or a nationalist. Whether you're educated or illiterate, whether you live on the boulevard or in the alley, you're going to catch hell just like I am. We're all in the same boat and we all are going to catch the same hell from the same man. He just happens to be a white man. All of us have suffered here, in this country, political oppression at the hands of the white man, economic exploitation at the hands of the white man, and social degradation at the hands of the white man. (Malcom X, 1964) This is a profound speech not only for the content in it but the fact that he seemed to touch on the point of acceptance from everyone. Equal opportunity to be treated as a human. He says Now in speaking like this, it doesn't mean that we're anti-white, but it does mean we're anti-exploitation, we're anti-degradation, and were anti-oppression. And if the white man doesn't want us to be anti-him let him stop oppressing and exploiting and degrading us. He wasnt a racist, but he wanted equality and thats probably the best part I can relate to. From experience it is irritating watching a person walk across the street because they assume I am a criminal, and while some statistics back that fact up it is irritating when I am a educated African American that served my country, so that people can continue to have the freedoms they poses today. I loved this speech, not for its anti-Semitism but for the purpose of it. Work Cited X, M. (1963, April 3). Malcolm X: The Ballot or the Bullet. Retrieved July 27, 2015, from edchange.org/multicultural/speeches/malcolm_x_ballot.html Dixon, E. (2011, January 4). Realism and Modernism, the Black Arts Movement, and Contemporary Literature. Retrieved July 27, 2015, from https://eng351wi2011finalproject.wordpress.com/about/education-and-literacy/realism-and-modernism/

Performance enhancing drugs in sports (which ones athletes use and the Research Paper

Performance enhancing drugs in sports (which ones athletes use and the benefits and possible side effects of using them) - Research Paper Example Some of them accept athletes as roll models in their life. This is a competitive world and the competition is spread in almost all sectors. By all means, sport is an important part of the competence. For surviving and winning in the competence at the sports field athletes want to maintain and boost their performance more and more. For this reason they always seek the methods for enhancing their performance in competitions and consider drug as the suitable stimuli for achieving their aims. Athletes prefer different types of performance enhancing drugs like anabolic steroids. There are certain reasons behind the use of drugs by athletes. In the book, Drugs in sports, David R. Mottram reveals many important factors related to the use of drugs in sports. In this book he denominates four reasons for the use of drugs in sports. They are listed below. Performance maintenance: - As part of the treatments which occurs at the time of their practicing or some other situation they forced to take treatments. At this time the medicines they took for the sports injuries many include drugs. From the above mentioned four points it is clear that athletes use drugs for improving their performance. Some of the important factors regarding the performance enhancing drugs in sports are discussed below. Almost all kinds of drugs preferred by the athletes contain substances which help the improvement of their athletic performance. It is not a new phenomenon; in the historical period itself athletes prefer drugs for their performance enrichment. It is not limited to one or two types. The most commonly preferred drug types are steroids and amphetamines and health supplements. First two types come under controlled substances, that is its production and distribution are controlled by the legal authority. One of the major reasons for this strict controlling is its high possibility of abuse especially by the athletes and trainers. Health supplements are

Performance appraisal policies Essay Example | Topics and Well Written Essays - 750 words

Performance appraisal policies - Essay Example Walmart, Google and Apple are very reputed companies in the global market and hold a significant place in the list of Fortune 500 companies. Discussing about the performance appraisal of these companies this can be said that Walmart is using performance appraisal system for the purpose of evaluation. The management of this company has set four standards which are below standard, above standard, standard and outstanding performance. According to these levels they are evaluating the productiveness of their employee’s performance in the organizational activities. New joiners are received two times evaluation at the first fiscal year and other employees receive the same one time in a year. Management has decided that all employees should spend at least 6 months at their current position before getting any kind of promotion. The employees who are giving outstanding performance in the organization can receive monetary reward at any time in a financial year. Compensation and benefit are structured according to the performance evaluation of every employees and it can differ from person to person (Armstrong, 2006). Again in case of Apple Inc. this can be said that this company does not provide any kind of guarantee for lifelong employment opportunities without standard performance. So management of this company always focuses on this fact that employees should take responsibilities to achieve target growth to survive in this company. The company has set organization centric goals and target to recruit only qualified and skilled persons in the respective fields. The management of the company is doing performance appraisal of its employees on annual basis and high performers are getting exclusive rewards for their performances. The company is paying a variety of incentives to its employees such as long term care insurance, employee